NAU5163, NAU5163 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU5163
Genbank IDDT564791
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
TM-1
Source SequenceDT564791.1
Source TypeEST
Repeat Motif(gaagag)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU5163_F: GACTCCCACCCTAACAACAG
Primer 2NAU5163_R: TTTTGCAAGAATCCTTCTCC
Restriction EnzymeEcoRI; NotI
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
TM-1breeding_germplasm
TM-1breeding_germplasm
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU5163_FNAU5163_FGossypium hirsutumprimer
NAU5163_RNAU5163_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
lint yieldqLY.SG-BIL_ch01-1.ay06Gossypium hirsutum x barbadenseQTL
micronaireqMIC.SG-BIL_ch01-1.ay07Gossypium hirsutum x barbadenseQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
embryogenic callus formationqECF.WT-F2:3_chr1-1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU5163NAU5163Gossypium hirsutummarker_locus
NAU5163-200NAU5163-200Gossypium hirsutummarker_locus
NAU5163NAU5163-50.877Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DT564791.1DT564791.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:58307462..58307677 +
A01chromosomeA01:96573291..96573500 +
CM018215.1chromosomeCM018215.1:57014401..57014616 +
CM018202.1chromosomeCM018202.1:105791952..105792155 +
D5_01chromosomeD5_01:51331295..51331504 +
KI_01chromosomeKI_01:34064094..34064303 +
Chr1chromosomeChr1:109723860..109724069 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:91786087..91786296 +
Chr9chromosomeChr9:10355903..10356112 +
D10_01chromosomeD10_01:5639931..5640146 -
CM016614.1chromosomeCM016614.1:127795047..127795256 +
scaffold1897.1supercontigscaffold1897.1:305922..306131 -
Dt_chr2chromosomeDt_chr2:10050267..10050482 -
D01chromosomeD01:55632349..55632564 +
A01chromosomeA01:92610094..92610303 +
Ghir_D01chromosomeGhir_D01:57274109..57274324 +
Ghir_A01chromosomeGhir_A01:110126985..110127194 +
D01chromosomeD01:58914506..58914721 +
A01chromosomeA01:110817617..110817826 +
D01chromosomeD01:58686908..58687123 +
A01chromosomeA01:108444742..108444951 +
D01chromosomeD01:55922682..55922897 +
A01chromosomeA01:105236201..105236404 +
scaffold6589supercontigscaffold6589:49401..49604 +
scaffold15630supercontigscaffold15630:177861..178076 -
scaffold15630supercontigscaffold15630:176428..176631 -
Gbar_D01chromosomeGbar_D01:57237119..57237334 +
Gbar_A01chromosomeGbar_A01:108210923..108211126 +
D01chromosomeD01:57874145..57874360 +
A01chromosomeA01:108178980..108179183 +
CM017623.1chromosomeCM017623.1:58116782..58117003 +
CM017610.1chromosomeCM017610.1:106798034..106798243 +
CM017649.1chromosomeCM017649.1:59509480..59509695 +
CM017636.1chromosomeCM017636.1:114183741..114183950 +
CM017701.1chromosomeCM017701.1:57598811..57599026 +
CM017688.1chromosomeCM017688.1:104265412..104265621 +
Sequence
>NAU5163 ID=NAU5163|Name=NAU5163|organism=Gossypium hirsutum|type=genetic_marker|length=216bp
GACTCCCACCCTAACAACAGCGCTATCTCTGACTTTGACAGTGCCCAATT
CTCCATCCCCGATGCCCTCAGAACTACCCCTCAACAACCTACCTGGGATG
TCCACCATAGGCAACGAGTTGAGCGGATATTCTCCAACGGCGATCTCCGC
CACAGAAAAGTTAAAGAAGAGGAAGAGGAAGAGGAAGAGGAGAGCAGGAG
AAGGATTCTTGCAAAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0180.67NAU5163View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0124NAU5163View
3(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr01-2N/AAD_chr.0163.3NAU5163View
4Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.0166.1NAU5163View
5DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.01107.32NAU5163View
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.15107.32NAU5163View
7W10 x TM-1, F2:3 (2015)WT-F2:3_chr01-1N/AAD_chr.0137NAU5163View
8DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0127.8NAU5163View
9DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1527.8NAU5163View
10SG 747 x Giza 75, BIL (2013)SG-BIL_chr01-1N/AAD_chr.0153.5NAU5163View
11CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01104.5NAU5163View
12TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0181.52NAU5163-200View
13TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0178.3NAU5163-200View
14CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0150.88NAU5163-50.877View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDT564791