BNL2921, BNL2921 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2921
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2921_orig
Source Typegenomic
Repeat Motif(AG)10
PCR ConditionAnnealing temperature: 55
Primer 1BNL2921_F: CGAGAGATTTTAAAGGGAAACA
Primer 2BNL2921_R: GGGAGTGGTCTGATGGAAAA
PolymorphismP_ BNL2921
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2921_FBNL2921_FGossypium hirsutumprimer
BNL2921_RBNL2921_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TSP-BNL2921Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2921BNL2921Gossypium hirsutummarker_locus
BLN2921-159BLN2921-159Gossypium hirsutummarker_locus
BNL2921bBNL2921bGossypium hirsutummarker_locus
BNL2921-154BNL2921-154Gossypium hirsutummarker_locus
BNL2921-160BNL2921-160Gossypium hirsutummarker_locus
BNL2921BNL2921-35.124Gossypium hirsutummarker_locus
BNL2921BNL2921-81.137Gossypium hirsutummarker_locus
BNL2921BNL2921-72.5Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2921_origBNL2921_origGossypium hirsutumsequence_feature


Sequence
>BNL2921 ID=BNL2921|Name=BNL2921|organism=Gossypium hirsutum|type=genetic_marker|length=158bp
CGAGAGATTTTAAAGGGAAACAAGTAAGAGAGAGAGAGAGAGAGAGCTCT
CAATTCGGGTGAAGAATGAGTAAAACATGAGGTAGTTGCAAAGTTTTTAA
AACTGAAAACCCTCACCTGATTTTCAAAATTTGGAGAATTTTCCATCAGA
CCACTCCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr01N/AAD_chr.0173.6BNL2921
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr01N/AAD_chr.01115.3BNL2921
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c01N/AAD_chr.0139.05BNL2921
4Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr01N/AAD_chr.0169.5BNL2921
5Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr01N/AAD_chr.0190BNL2921
6Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr01N/AAD_chr.01100BNL2921
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr01N/AAD_chr.0146BNL2921
8TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c01N/AAD_chr.0163.24BNL2921
9Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg23/chr01N/AAD_chr.010BNL2921
10Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0139.13BNL2921
11DH962 x Jinmian-6, F2 (2009)DJ-F2_chrU/LG6N/AAD_chr.unknown101.1BNL2921
12Yumian-1 x 7235, RIL (2015)Y7-RIL_chr01N/AAD_chr.0146.4BNL2921
13DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0194.89BNL2921
14DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1594.89BNL2921
15TM-1 x 3-79, RIL (2014)T3-RIL.14_chr01N/AAD_chr.0181.1BNL2921
16DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0138.2BNL2921
17DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1538.2BNL2921
18CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr01N/AAD_chr.01124.9BNL2921
19Deltapine-61 x Texas-701, F2 (2007)Deltapine-61 x Texas-701, F2 (2007).DT-F2_chr.01N/AAD_chr.0135.7BLN2921-159
20Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr01N/AAD_chr.0166BNL2921b
21HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr01N/AAD_chr.010BNL2921-154
22TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr01/A1N/AAD_chr.0171.55BNL2921-160
23Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr01.1N/AAD_chr.0110BNL2921-160
24TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr01N/AAD_chr.0169.1BNL2921-160
25CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr01N/AAt.0135.12BNL2921
26TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.01N/AAD_chr.0181.14BNL2921
27PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr01N/AAt.0172.5BNL2921
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]