BNL2662, BNL2662 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2662
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2662_orig
Source Typegenomic
Repeat Motif(CT)15
PCR ConditionAnnealing temperature: 55
Primer 1BNL2662_F: TACAACAGACCGCATCACAGTG
Primer 2BNL2662_R: TCGAGGTACTCTCTCTCTCTCTCTC
PolymorphismP_ BNL2662
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2662_FBNL2662_FGossypium hirsutumprimer
BNL2662_RBNL2662_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2662BNL2662Gossypium hirsutummarker_locus
BNL2662/90t(C5)BNL2662/90t(C5)Gossypium hirsutummarker_locus
BNL2662(C5)BNL2662(C5)Gossypium hirsutummarker_locus
BNL2662BNL2662-125.057Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2662_origBNL2662_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D11chromosomeD11:65886042..65886128 +
D10_11chromosomeD10_11:63147279..63147365 -
D11chromosomeD11:59769305..59769391 +
Ghir_D11chromosomeGhir_D11:66713749..66713835 -
D11chromosomeD11:65561525..65561611 -
D11chromosomeD11:63457243..63457329 -
Dt11chromosomeDt11:62334188..62334256 +
scaffold31745supercontigscaffold31745:6973..7041 +
Gbar_D11chromosomeGbar_D11:63498723..63498791 -
CM017633.1chromosomeCM017633.1:65643715..65643797 -
CM017659.1chromosomeCM017659.1:67627564..67627646 -
Chr07chromosomeBNL2662:1..294 .
Chr07:56143040..56143323 -
Chr7chromosomeBNL2662:1..294 .
Chr7:5702632..5702915 +
Sequence
>BNL2662 ID=BNL2662|Name=BNL2662|organism=Gossypium hirsutum|type=genetic_marker|length=87bp
TACAACAGACCGCATCACAGTGAAAGGCATGTCCAATGGATGTGTCATTA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGTACCTCGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr05N/AAD_chr.05170.4BNL2662
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c05N/AAD_chr.0552.85BNL2662
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr21N/AAD_chr.21150BNL2662
4AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05167BNL2662
5Xinluzao-1 x Hai-7124, F2 (2008)Xinluzao-1 x Hai-7124, F2 (2008).XH-F2_lg2N/AAD_unknown198BNL2662
6Yumian-1 x T586, F2:3 (2005)Yumian-1 x T586, F2:3 (2005).YT-F2:3_chr05.3N/AAD_chr.050BNL2662
7TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c21N/AAD_chr.21117.7BNL2662
8Yumian-1 x T586, RIL (2006)YT-RIL_chr21-1N/AAD_chr.217.6BNL2662
9Yumian-1 x T586, RIL (2015)YT-RIL.15_chr21N/AAD_chr.21151.6BNL2662
10TM-1 x 3-79, RIL (2014)T3-RIL.14_chr21N/AAD_chr.21125.1BNL2662
11W10 x TM-1, F2:3 (2015)WT-F2:3_chr21N/AAD_chr.2120.2BNL2662
12Yumian-1 x T586, RIL (2009)YT-RIL_chr21N/AAD_chr.217.1BNL2662/90t(C5)
13Yumian-1 x T586, F2:3 (2005.v0)YT-F2:3_chr05-3N/AAD_chr.050BNL2662(C5)
14TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.21N/AAD_chr.21125.06BNL2662