BNL1495, BNL1495 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1495
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL1495_orig
Source Typegenomic
Repeat Motif(AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL1495_F: TGAAGATTTGGAGGCAATTG
Primer 2BNL1495_R: ATAAATGGCATCAGCCCAAA
PolymorphismP_ BNL1495
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1495_FBNL1495_FGossypium hirsutumprimer
BNL1495_RBNL1495_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.GG-F2_ch13.cz08.1Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1495BNL1495Gossypium hirsutummarker_locus
BNL1495-113BNL1495-113Gossypium hirsutummarker_locus
BNL1495-120BNL1495-120Gossypium hirsutummarker_locus
BNL1495BNL1495-53.369Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1495_origBNL1495_origGossypium hirsutumsequence_feature


Sequence
>BNL1495 ID=BNL1495|Name=BNL1495|organism=Gossypium hirsutum|type=genetic_marker|length=128bp
TGAAGATTTGGAGGCAATTGTCTTAAAGGGAGAGAGAGAGAGAGAGAGAG
AGAGAGAGGATAATTATCTTATACACTGTCAGTGGAGTAAAGAAACTCTA
CAAACGCGTTTGGGCTGATGCCATTTAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A01N/AAD_chr.1396.2BNL1495View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.13107.41BNL1495View
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.13110BNL1495View
4TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.18bN/AAD_chr.1833.7BNL1495View
5TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c13N/AAD_chr.1356.78BNL1495View
6Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.13163.5BNL1495View
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13119BNL1495View
8H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.1353.5BNL1495View
9TM-1 x 3-79, RIL (2014)T3-RIL.14_chr13N/AAD_chr.1353.4BNL1495View
10W10 x TM-1, F2:3 (2015)WT-F2:3_chr13N/AAD_chr.1325.6BNL1495View
11GX1135 x GX100-2, F2 (2013)GG-F2_chr13N/AAD_chr.13127.8BNL1495View
12GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr13N/AAD_chr.1373.4BNL1495View
13CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.13106.4BNL1495View
14HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr13N/AAD_chr.132BNL1495-113View
15Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgA01N/AAD_chr.1352.5BNL1495-120View
16TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1368.2BNL1495-120View
17TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1368.56BNL1495-120View
18TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.13N/AAD_chr.1353.37BNL1495View
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]