TMB1738, TMB1738 (genetic_marker) Gossypium hirsutum

Marker Overview
NameTMB1738
AliasTMH C18-G20
Genbank IDBV679659
TypeSSR
SpeciesGossypium hirsutum
GermplasmTM-1
Source SequenceBV679659.1
Source Typegenomic
Repeat Motif(CA)27
PCR ConditionAnnealing temperature: 55
Primer 1TMB1738_F: TTGTTAGCAATATGCAATATGAAC
Primer 2TMB1738_R: GGGTTTAGTTGAATGGGACC
Product Length249
PolymorphismP_ TMB1738
ContactYu, John Z. (Zhi-Hong)
CommentPrimer data obtained in 2005-10
Germplasm
Stock NameType
TM-1breeding_germplasm
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TMB1738_FTMB1738_FGossypium hirsutumprimer
TMB1738_RTMB1738_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TMB1738TMB1738Gossypium hirsutummarker_locus
TMB1738TMB1738-6.489Gossypium hirsutummarker_locus
TMB1738TMB1738-119.674Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BV679659.1BV679659.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Yu, John Z. (Zhi-Hong)
Description:Cotton molecular genetics and genomics including integrative genome mapping and QTL identification from the Gossypium germplasm.
First name:John
Last name:Yu
Title:Research Geneticist
Institution:USDA-ARS
Address:2765 F&B Road, College Station, Texas 77845
Country:United States
Email:zyu@qutun.tamu.edu
Phone:1-979-260-9237
Fax:1-979-260-9333
Keywords:Cotton Molecular Genetics
Last update:6-Sep-2007
Sequence
>TMB1738 ID=TMB1738|Name=TMB1738|organism=Gossypium hirsutum|type=genetic_marker|length=249bp
TTGTTAGCAATATGCAATATGAACACACACACACACACACACACACACAC
ACACACACACACACACACACACACACAGATGTATGTATATAAGGGTTGAT
TTGCAAGTCAATGGACGTGACTGATTTTCATGCAATTATTTGTATTTATT
AAAATATTTAGATTTTTTTTTAAGATTTTCAACCGGTTAAATAGGGAATT
AATGGTTTGATTGGTTGGATTACTAATTTGGTCCCATTCAACTAAACCC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr02N/AAD_chr.029.99TMB1738View
2TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c02N/AAD_chr.02118.38TMB1738View
3AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.02182TMB1738View
4Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.027.7TMB1738View
5TM-1 x 3-79, RIL (2014)T3-RIL.14_chr02N/AAD_chr.02119.7TMB1738View
6W10 x TM-1, F2:3 (2015)WT-F2:3_chr02-1N/AAD_chr.020TMB1738View
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0219.4TMB1738View
8CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr02N/AAD_chr.02111.1TMB1738View
9CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr02N/AAt.026.49TMB1738-6.489View
10TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.02N/AAD_chr.02119.67TMB1738-119.674View
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBV679659