BNL0409, BNL0409 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL0409
AliasBNL409
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL0409_orig
Source Typegenomic
Repeat Motif(GA)12
PCR ConditionAnnealing temperature: 55
Primer 1BNL0409_F: AGAAGTCGGACGTGGAAAGA
Primer 2BNL0409_R: GCCGTTTTCCTCAGTGATGT
PolymorphismP_ BNL0409
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL0409_FBNL0409_FGossypium hirsutumprimer
BNL0409_RBNL0409_RGossypium hirsutumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.TSP-BNL0409Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL409BNL409Gossypium hirsutummarker_locus
BNL0409BNL0409Gossypium hirsutummarker_locus
BNL409-100BNL409-100Gossypium hirsutummarker_locus
BNL0409BNL0409-13.182Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL0409_origBNL0409_origGossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A13chromosomeA13:808216..808317 -
Chr13chromosomeChr13:71493651..71493747 +
Chr13_CRI-A2_v1.0.a1chromosomeChr13_CRI-A2_v1.0.a1:756829..756925 -
At_chr9chromosomeAt_chr9:55426004..55426105 -
A13chromosomeA13:603331..603432 -
Ghir_A13chromosomeGhir_A13:566622..566723 -
A13chromosomeA13:792102..792203 -
A13chromosomeA13:827281..827382 -
A13chromosomeA13:651019..651120 -
scaffold3562supercontigscaffold3562:52942..53017 +
Gbar_A13chromosomeGbar_A13:737069..737144 -
CM017622.1chromosomeCM017622.1:791265..791364 -
CM017648.1chromosomeCM017648.1:727987..728084 -
Chr13chromosomeBNL0409:1..310 .
Chr13:548161..548339 -
Sequence
>BNL0409 ID=BNL0409|Name=BNL0409|organism=Gossypium hirsutum|type=genetic_marker|length=102bp
AGAAGTCGGACGTGGAAAGACAGTAAATATCGAGAGAGAGAGAGAGAGAG
AGAGAACTGACTAGGAAGTAGGATATGAAAAGACATCACTGAGGAAAACG
GC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr13N/AAD_chr.13194.7BNL409View
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.13217.4BNL409View
3H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.131.1BNL409View
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch13/lgA01N/AAD_chr.1365.44BNL0409View
5Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.13150BNL0409View
6TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c13N/AAD_chr.1313.43BNL0409View
7AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13209BNL0409View
8TM-1 x 3-79, RIL (2014)T3-RIL.14_chr13N/AAD_chr.1313.2BNL0409View
9Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_chr09.1N/AAD_chr.0911BNL409-100View
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.13126.6BNL409-100View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.13128.15BNL409-100View
12TM-1 x Hai-7124, BC1 (2005.v0)TH-RIL_chr09N/AAD_chr.0945.38BNL409-100View
13TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.13N/AAD_chr.1313.18BNL0409View