|
Cross References
External references for this genetic_marker
Alignments
The following features are aligned
Publications
Year | Publication |
2004 | Rong J, Abbey C, Bowers JE, Brubaker CL, Chang C, Chee PW, Delmonte TA, Ding X, Garza JJ, Marler BS, Park CH, Pierce GJ, Rainey KM, Rastogi VK, Schulze SR, Trolinder NL, Wendel JF, Wilkins TA, Williams-Coplin TD, Wing RA, Wright RJ, Zhao X, Zhu L, Paterson AH. A 3347-locus genetic recombination map of sequence-tagged sites reveals features of genome organization, transmission and evolution of cotton (Gossypium). Genetics. 2004 Jan; 166(1):389-417. |
Germplasm
Stock Name | Type |
T-25 | accession |
Map Positions
# | Map Name | Linkage Group | Bin | Position | Locus | MapViewer |
1 | Deltapine-61 x Seaberry, F2 (2000) | AD_ch04_At.04 | N/A | 0 | pAR0138a | View |
2 | Pima S-7 x im, F2 (2007) | AD_ch04_At.04 | N/A | 19.6 | pAR0138a | View |
3 | Sic'on x F-177, F2 (2004) | AD_ch04_At.04 | N/A | 22.4 | pAR0138a | View |
4 | Pima S-7 x Empire, F2 (2007) | AD_ch10_At.10 | N/A | 20.8 | pAR0138a | View |
5 | Pima S-7 x Empire, F2 (2007) | AD_ch20_Dt.10 | N/A | 20.8 | pAR0138a | View |
6 | Deltapine-61 x Seaberry, F2 (2000) | AD_ch22_Dt.04 | N/A | 10.6 | pAR0138 | View |
7 | AD-genome wide Reference Map (2009) | AD_ch22_Dt.04 | N/A | 23 | pAR0138 | View |
8 | AD-genome wide Reference Map (2009) | AD_ch04_At.04 | N/A | 33 | pAR0138 | View |
9 | SMA-4 x A1-97, F2 (2005) | A_SA_lg14 | N/A | 23.4 | pAR0138 | View |
10 | TM-1 x WT-936, F2 (2005) | AD_ch04_At.04 | N/A | 0 | pAR0138 | View |
11 | TM-1 x WT-936, F2 (2005) | AD_ch22_Dt.04 | N/A | 32 | pAR0138 | View |
12 | Guazuncho-2 x VH8-4602, BC1 (2005) | AD_ch04_At.04 | N/A | 60.6 | pAR138a | View |
13 | Palmeri x K-101, F2 (2007) | AD_ch04_At.04 | N/A | 31.8 | pAR138a | View |
14 | Guazuncho-2 x VH8-4602, consensus (2009) | AD_ch04_At.04 | N/A | 21.09 | pAR138 | View |
15 | Palmeri x K-101, F2 (2007) | AD_ch22_Dt.04 | N/A | 18.6 | pAR138b | View |
16 | Pima S-7 x Empire, F2 (2007) | AD_ch22_Dt.04 | N/A | 7.7 | pAR0138b | View |
17 | Pima S-7 x im, F2 (2007) | AD_ch22_Dt.04 | N/A | 17.2 | pAR0138b | View |
Sequence
>pAR0138 ID=pAR0138; Name=pAR0138; organism=Gossypium hirsutum; type=genetic_marker; length=192bp GCACGAGNAAAAAATGAAGCTCTTGTTTCTAACTTTGCTGCTTTGTTCTC TTCTTCTATGTTCTTCAGTTTTTGCACCAACAATGGCTCAGCCTCGTTCA CCTTTTTGTGAAGGGAAATGCAAAGGGAGGTGCAATAAAGCGGCGGTTTG GGATCGGTGCTTCAAATATTGCGGCATATGTTGCGAGGAGTG
|