first fruit branch position, qFFBH.3T-F2_c13 (QTL) Gossypium hirsutum

QTL Overview
QTL LabelqFFBH.3T-F2_c13
Published SymbolqGhFFSH-c13
Trait Namefirst fruit branch position
Trait AliasN/A
Trait Study3T-F2-2017
Population3-79 x TM-1, F2
Female Parent3-79
Male ParentTM-1
Colocalizing MarkerTAMU_Gb379_021157
Neighboring MarkerN/A
EnvironmentN/A
LODN/A
Additivity Dominance RatioN/A
R24.68
Comments503 G. hirsutum accessions, derived from five main China cotton belts and imported lines from UR and USA. Phenotype data were collected from 4 locations (Hubei Huangang, Henan Yuanyang, Xinjiang Korla, and Xinjiang Shihezi) in 2012 and 2013.
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
A13chromosomeA13:2683077..2683177 .Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1CottonGen QTL alignment to genome using associated markers
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
13-79 x TM-1, F2 (2015 SNP)AD_ch13_At.13N/AN/A181618View
Sequences
The following sequences are available for this feature:

QTL from alignment at A13:2683077..2683177

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qFFBH.3T-F2_c13 ID=qFFBH.3T-F2_c13; Name=first fruit branch position; organism=Gossypium hirsutum; type=QTL; length=101bp; location=Sequence derived from: A13:2683077..2683177 (Gossypium hirsutum
GTCTGGTCGTCTATCCGGAAAGACCTCTGTGAATATTACCGAACCCCGCC
AGATCTTAAGGGGTTATCCCTTGCAAGTTTCAACTTTGAAAGAAATGAAC
G
back to top