NAU1230, NAU1230 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1230
Genbank IDBG440224
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCAAGC)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU1230_F: CATGCAAATCCATGCTAGAG
Primer 2NAU1230_R: TCAAAAGGTTCTTTGGTGGT
Product Length247
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBG440224
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1230_FNAU1230_FGossypium arboreumprimer
NAU1230_RNAU1230_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1230NAU1230Gossypium arboreummarker_locus
NAU1230/210yNAU1230/210yGossypium arboreummarker_locus
NAU1230NAU1230-99.117Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU1230 ID=NAU1230|Name=NAU1230|organism=Gossypium arboreum|type=genetic_marker|length=247bp
CATGCAAATCCATGCTAGAGAGTACTTCAGCAAATTCCCAAGAGTTAACA
CCAATGAGAAAGAGACNNACACCAGAGAGCANAAGCACGAGACCTTCGTT
CCCCAGAACACCCCAAAGCCAGAAGAAACAGAGCCAAGGGTCATCCCTGG
AAACCCAAATGGGGTATGGGCTTTANGGGCACGAATCAAGCTCAAGCTCA
AGCTCAAGCTCAAGCCGGNCCAGTTTTACCACCAAAGAACCTTTTGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_A05-3N/AAD_chr.054.5NAU1230
2Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch19/D05N/AAD_chr.190.2NAU1230
3Yumian-1 x T586, RIL (2006)YT-RIL_chr05-2N/AAD_chr.0511.8NAU1230
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0572.1NAU1230
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr19/LGD08-1N/AAD_chr.190.8NAU1230
660182 x Jun Mian 1, F2:3 (2007)6J-F2:3_chr23N/AAD_chr.235.1NAU1230
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr05N/AAD_chr.0552.9NAU1230
8Baimian 1 x TM-1 , F2:3 (2014)BT-F2:3_chr19-2N/AAD_chr.1942.7NAU1230
9Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0514NAU1230
10TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr19-1N/AAD_chr.1921.8NAU1230
110-153 x sGK9708, RIL (2016)0s-RIL_chr19-1N/AAD_chr.1916.7NAU1230
12CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.0559.6NAU1230
13901-001 x sGK156, F2 (2019)Chr19N/AAD_chr.1916.62NAU1230
14Yumian-1 x T586, RIL (2009)YT-RIL_chr05N/AAD_chr.0511.8NAU1230/210y
15CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0599.12NAU1230