HAU2102, HAU2102 (genetic_marker) gossypium spp

Marker Overview
NameHAU2102
Genbank IDES830252
TypeSSR
SpeciesGossypium spp.
Source TypeEST
Repeat Motif(GAC)6
PCR ConditionAnnealing temperature: 56.8
Primer 1HAU2102_F: GTGGCGAACCGGAAGAGGAA
Primer 2HAU2102_R: CTCGCCCTCGTCGTCATCAG
Product Length164
Publication[view all]
CommentPrimer data obtained in 2012
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankEX164726
DB:genbankES830252
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
HAU2102_FHAU2102_FGossypium spp.primer
HAU2102_RHAU2102_RGossypium spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
HAU2102HAU2102Gossypium spp.marker_locus
HAU2102aHAU2102aGossypium spp.marker_locus
HAU2102bHAU2102bGossypium spp.marker_locus


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
A01chromosomeA01:3485822..3485985 +
A01chromosomeA01:3184591..3184754 +
CM018215.1chromosomeCM018215.1:2303249..2303412 +
CM018202.1chromosomeCM018202.1:2507517..2507683 +
D5_01chromosomeD5_01:2334847..2335016 +
Chr7chromosomeChr7:107772289..107772455 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:2475842..2476008 +
Chr8chromosomeChr8:61997456..61997625 -
D10_01chromosomeD10_01:58264155..58264324 -
CM016614.1chromosomeCM016614.1:3431816..3431978 +
scaffold1463.1supercontigscaffold1463.1:72715..72878 -
scaffold3710_D01supercontigscaffold3710_D01:110055..110218 +
A01chromosomeA01:2245829..2245992 +
Ghir_D01chromosomeGhir_D01:2493662..2493825 +
Ghir_A01chromosomeGhir_A01:2781006..2781169 +
D01chromosomeD01:2371547..2371710 +
A01chromosomeA01:2674833..2674996 +
D01chromosomeD01:2488389..2488552 +
A01chromosomeA01:2800692..2800855 +
D01chromosomeD01:2291087..2291250 +
A01chromosomeA01:2752655..2752818 +
scaffold7906supercontigscaffold7906:604275..604438 +
scaffold12265supercontigscaffold12265:278148..278314 -
Gbar_D01chromosomeGbar_D01:2534718..2534881 +
Gbar_A01chromosomeGbar_A01:2497020..2497186 +
D01chromosomeD01:2432217..2432380 +
A01chromosomeA01:2497583..2497749 +
CM017623.1chromosomeCM017623.1:2545957..2546120 +
CM017610.1chromosomeCM017610.1:3016531..3016694 +
CM017649.1chromosomeCM017649.1:2357171..2357334 +
CM017636.1chromosomeCM017636.1:2542692..2542864 +
CM017701.1chromosomeCM017701.1:2681796..2681959 +
CM017688.1chromosomeCM017688.1:2524291..2524445 +
Sequence
>HAU2102 ID=HAU2102|Name=HAU2102|organism=Gossypium spp.|type=genetic_marker|length=164bp
GTGGCGAACCGGAAGAGGAAGACGACGATGACGACGACGAGGATGAGGAT
GATGAAGGCGAAGATGACGACGACGACGACGACGAAGGAGAGGAGGATGA
CGATGTGCAGGTTCTTCACTCATCCGGTCCTCCTGTCCTGATAGCTGATG
ACGACGAGGGCGAG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr01N/AAD_chr.0178.5HAU2102
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr01N/AAD_chr.016.4HAU2102
3DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr01N/AAD_chr.0193.5HAU2102
4DH962 x Ji Mian 5, RIL (2015)DJiM-RIL_chr15N/AAD_chr.1593.5HAU2102
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr01N/AAt.01136.5HAU2102
6DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0131.65HAU2102a
7DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1531.65HAU2102a
8CCRI-36 x G2005, RIL (2016)CG-RIL_chr15N/AAD_chr.152.6HAU2102a
9DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr01N/AAD_chr.0128.16HAU2102b
10DH962 X Ji Mian 5, F2 (2015)DJiM-F2_chr15-1N/AAD_chr.1528.16HAU2102b