Gh316, Gh316 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	Gh316
Genbank ID	DQ908255
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	DQ908255
Source Type	genomic
Repeat Motif	CTT(30)
Primer 1	Gh316_F: ACGCTTCTTCCTCTTATTCTTCC
Primer 2	Gh316_R: TGAATCAAACAAGAACACAGCAGC
Publication	[view all]
Comment	Primer data obtained in 2008-01 from Hoffman, Steve M.

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	DQ908255

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
A03	chromosome	A03:23708512..23708697 +	Gossypium hirsutum (AD1) 'TM-1' genome UTX-JGI-Interim-release_v1.1	n/a
Chr11_CRI-A2_v1.0.a1	chromosome	Chr11_CRI-A2_v1.0.a1:51437890..51438045 -	Gossypium arboreum (A2) 'SXY1' genome CRI-updated_v1	n/a
At_chr1	chromosome	At_chr1:25643797..25643970 +	Gossypium hirsutum (AD1) 'TM-1' genome CGP-BGI_v1	n/a
scaffold2958_A11	supercontig	scaffold2958_A11:917935..918141 +	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	n/a
Ghir_A11	chromosome	Ghir_A11:70724153..70724334 +	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
A11	chromosome	A11:68297972..68298157 +	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
A11	chromosome	A11:68394682..68394867 +	Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1	n/a
A11	chromosome	A11:66732138..66732329 +	Gossypium hirsutum (AD1) 'ZM24' genome CRI_v1	n/a
Gbar_A11	chromosome	Gbar_A11:64878115..64878249 +	Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1	n/a
CM017646.1	chromosome	CM017646.1:72863940..72864116 +	Gossypium mustelinum (AD4) genome JGI_v1.1	n/a
A11	chromosome	A11:70447862..70448041 +	Gossypium hirsutum (AD1) 'TM-1' genome UTX_v2.1	n/a
Chr11	chromosome	Chr11:72186055..72186210 +	Gossypium arboreum (A2) 'SXY1' genome WHU-updated v1	n/a

Publications


Year	Publication
2007	Hoffman S, Yu J, Grum D, Xiao J, Kohel R, Pepper A. Identification of 700 New Microsatellite Loci from Cotton (G. hirsutum L.). Journal of cotton science. 2007; 11(4):208-241

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
DQ908255	DQ908255	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Emian-22 x 3-79, BC1 (2011)	AD_ch11_At.11	N/A	90.67	Gh316	View
2	TM-1 x 3-79, RIL (2012)	AD_ch11_At.11	N/A	108.14	Gh316	View
3	(YM1 x CCRI35) x (YM1 x 7235), 4WC (2012)	AD_ch11_At.11	N/A	25.9	Gh316	View
4	Yumian-1 x T586, RIL (2015)	AD_ch11_At.11	N/A	60	Gh316	View
5	Yumian-1 x 7235, RIL (2015)	AD_ch11_At.11	N/A	64.5	Gh316	View
6	TM-1 x 3-79, RIL (2014)	AD_ch11_At.11	N/A	105.8	Gh316	View
7	GX1135 x GX100-2, F2 (2013)	AD_ch11_At.11	N/A	2	Gh316	View
8	GX1135 x GX100-2, RIL (2016)	AD_ch11_At.11	N/A	196.4	Gh316	View
9	TM-1 x 3-79, RIL (2012.v3)	AD_ch11_At.11	N/A	105.83	GH316	View
10	TM-1 x Hai-7124, BC1 (2012)	AD_ch11_At.11	N/A	87.8	Gh316-140	View

Sequence

>Gh316 ID=Gh316; Name=Gh316; organism=Gossypium hirsutum; type=genetic_marker; length=186bp
ACGCTTCTTCCTCTTATTCTTCCTCTTCTTCTTCTTCTTTTTCCTCTTCT
TCCTCTTCCTCTTCTTCCTCTTCCTCTTCCTCTTCCTCTTCTTTCTTTTC
TTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT
CTTCTTCTTGTTGCTGCTGTGTTCTTGTTTGATTCA

Search form

Gh316, Gh316 (genetic_marker) Gossypium hirsutum