DC40175, DC40175 (genetic_marker) Gossypium hirsutum

Marker Overview
NameDC40175
Genbank IDGQ394652
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1675
Source Typegenomic
Primer 1DC40175_F: TTGCTCAGGTTTTGATGTC
Primer 2DC40175_R: AGGTGATGACCATCGGTA
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394652
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40175_FDC40175_FGossypium hirsutumprimer
DC40175_RDC40175_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber strengthqFS.GG-F2_ch01.cz08Gossypium hirsutumQTL
fiber strengthqFS.GG-F2_ch01.sy07Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch15.xy12-bcGossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch15.xy12.1Gossypium hirsutumQTL
micronaireqMIC.GG-RIL.16_ch15.xy12.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC40175DC40175Gossypium hirsutummarker_locus
DC40175DC40175-45.759Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1675MONCS1675Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:56442451..56442696 +
A01chromosomeA01:94136528..94136750 +
CM018215.1chromosomeCM018215.1:55178869..55179090 +
CM018202.1chromosomeCM018202.1:103336314..103336536 +
D5_01chromosomeD5_01:49578896..49579119 +
KI_01chromosomeKI_01:33153736..33153954 +
Chr2chromosomeChr2:32497025..32497249 -
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:88966116..88966340 +
Chr2chromosomeChr2:5699300..5699523 +
D10_01chromosomeD10_01:7383983..7384212 -
CM016614.1chromosomeCM016614.1:125124175..125124402 +
scaffold39.1supercontigscaffold39.1:2380577..2380799 -
Dt_chr2chromosomeDt_chr2:11323938..11324183 -
D01chromosomeD01:53739206..53739451 +
A01chromosomeA01:90203516..90203738 +
Ghir_D01chromosomeGhir_D01:55417486..55417730 +
Ghir_A01chromosomeGhir_A01:107731142..107731364 +
D01chromosomeD01:57115114..57115359 +
A01chromosomeA01:108394305..108394527 +
D01chromosomeD01:56827609..56827854 +
A01chromosomeA01:105981554..105981776 +
D01chromosomeD01:54066168..54066413 +
A01chromosomeA01:102883322..102883544 +
scaffold2537supercontigscaffold2537:250233..250455 -
scaffold2537supercontigscaffold2537:246166..246388 -
Gbar_D01chromosomeGbar_D01:55383192..55383413 +
Gbar_A01chromosomeGbar_A01:105828952..105829174 +
D01chromosomeD01:56090538..56090759 +
A01chromosomeA01:105866099..105866321 +
CM017623.1chromosomeCM017623.1:56198539..56198774 +
CM017610.1chromosomeCM017610.1:104454625..104454847 +
CM017649.1chromosomeCM017649.1:57677716..57677955 +
CM017636.1chromosomeCM017636.1:111725874..111726096 +
CM017701.1chromosomeCM017701.1:55701418..55701639 +
CM017688.1chromosomeCM017688.1:102003226..102003448 +
Sequence
>DC40175 ID=DC40175|Name=DC40175|organism=Gossypium hirsutum|type=genetic_marker|length=244bp
TTGCTCAGGTTTTGATGTCATATATATAGTATGTTTATTTTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGGTTACTGCTAAAAAGACTAAAAATCT
TATTTGTTTGTGTGATAGACTCGGTTGAGCGAAGAAGCAGCAGATGCCGT
AAAGCAATTGTTGCCAAAATGGGCGGAAGATGATCTAGGGAGCGTGTGTT
CATGGGCGGATCAAGTGAAGTTCCGTTACCGATGGTCATCACCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr15N/AAD_chr.1550DC40175View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr15N/AAD_chr.1545.8DC40175View
3GX1135 x GX100-2, F2 (2013)GG-F2_chr01N/AAD_chr.0179.8DC40175View
4GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr15N/AAD_chr.150.6DC40175View
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr15N/AAD_chr.150.6DC40175View
6TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.15N/AAD_chr.1545.76DC40175View