CGR5534, CGR5534 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCGR5534
Genbank IDGQ393539
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 33 B
Source SequenceMONCS0504
Source Typegenomic
PCR ConditionAnnealing temperature: 55
Primer 1CGR5534_F: TCAAGTGCAGCAAGGATGTC
Primer 2CGR5534_R: TGAACACTGGCGTTCTGAAG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Deltapine 33 BTBD
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ393539
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
CGR5534_FCGR5534_FGossypium hirsutumprimer
CGR5534_RCGR5534_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CGR5534CGR5534Gossypium hirsutummarker_locus
CGR5534CGR5534-17.3Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS0504MONCS0504Gossypium hirsutumsequence_feature


Contact
NameDetails
Monsanto
Country:United States
Sequence
>CGR5534 ID=CGR5534|Name=CGR5534|organism=Gossypium hirsutum|type=genetic_marker|length=142bp
TCAAGTGCAGCAAGGATGTCCATCTCTCTTTTTGAATCCAACGTTCGGTT
CTCCAACCATCCCTTGAGATTTTCTTTTCTGTTTCTCTCTCTCTCTCTCT
CTCTCTCTCTCCACTTCCATATCTTCAGAACGCCAGTGTTCA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr02N/AAD_chr.0290CGR5534View
2Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.0216.8CGR5534View
3GX1135 x GX100-2, F2 (2013)GG-F2_chr11-2N/AAD_chr.1154.3CGR5534View
4GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.027.4CGR5534View
5GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.027.4CGR5534View
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.0214.8CGR5534View
7MGG-293-793, MAGIC (2018)MAGIC-19831_chr02N/AAD_chr.0217.3CGR5534View