BNL2571, BNL2571 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL2571
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceBNL2571_orig
Source Typegenomic
Repeat Motif(AG)13, (TC)13
PCR ConditionAnnealing temperature: 55
Primer 1BNL2571_F: TCGCTATCGCTCTGAAATCA
Primer 2BNL2571_R: ATGCCACGGAATTAGCAAAC
PolymorphismP_ BNL2571
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL2571_FBNL2571_FGossypium hirsutumprimer
BNL2571_RBNL2571_RGossypium hirsutumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
leaf shapeqLFSP.TH-BC1_ch13Gossypium spp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2571aBNL2571aGossypium hirsutummarker_locus
BNL2571bBNL2571bGossypium hirsutummarker_locus
BNL2571BNL2571Gossypium hirsutummarker_locus
BNL2571-280BNL2571-280Gossypium hirsutummarker_locus
BNL2571-260BNL2571-260Gossypium hirsutummarker_locus
BNL2571_230BNL2571_230Gossypium hirsutummarker_locus
BNL2571_260BNL2571_260Gossypium hirsutummarker_locus
BNL2571BNL2571-79.92Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
BNL2571_origBNL2571_origGossypium hirsutumsequence_feature


Sequence
>BNL2571 ID=BNL2571|Name=BNL2571|organism=Gossypium hirsutum|type=genetic_marker|length=249bp
TCGCTATCGCTCTGAAATCAATCAATGAAACAAATAAATATACCCAAAAA
AAACTTGTTGAGAATGAAAATTTTCTCTTTTCTCTCTCTCTCTCTCTCTC
TCTCTCTGTGTTTCTGGTGGGGTTTTTTTCGTTTTTTTTTTTTTNNNGGA
TTGGTACCCAAAAGTAGGAATTTATGGGTCAGCCAGTGGTTTTGTCGGGG
TTGGGGGGCATTGGCTTGCAAAGGATGTCGTTTGCTAATTCCGTGGCAT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A01N/AAD_chr.1345BNL2571a
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.1353.6BNL2571a
3Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr13/lgA01N/AAD_chr.1314.4BNL2571a
4Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr13/lgA01N/AAD_chr.1351.5BNL2571a
5CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr18N/AAD_chr.1867.3BNL2571b
6Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr18N/AAD_chr.1825.7BNL2571b
7Palmeri x K-101, F2 (2007)Palmeri x K-101, F2 (2007).PK-F2_chr18N/AAD_chr.1831.3BNL2571b
8Guazuncho-2 x VH8-4602, BC2 (2005)Guazuncho-2 x VH8-4602, BC2 (2005).GV-BC2_chr18N/AAD_chr.186BNL2571b
9Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.1331.8BNL2571
10Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c18N/AAD_chr.1823.69BNL2571
11Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch18N/AAD_chr.1815.54BNL2571
12Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr18N/AAD_chr.1850BNL2571
13AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr18N/AAD_chr.1872BNL2571
14Handan-208 x Pima-90, F2:3 (2007)Handan-208 x Pima-90, F2:3 (2007).HP-F2:3_chr13/lgA01N/AAD_chr.13178BNL2571
15AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.1338BNL2571
16H18 x 3-79, F2 (2005)H18P379-F2_chr18N/AAD_chr.18140.5BNL2571
17H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.13157.1BNL2571
18SG 747 x Giza 75, BIL (2013)SG-BIL_chr13N/AAD_chr.131.8BNL2571
19TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1332.04BNL2571-280
20TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1326.8BNL2571-280
21TM-1 x Hai-7124, BC1 (2005.v0)TH-RIL_chr13/lgA01N/AAD_chr.13190.3BNL2571-280
22TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr18N/AAD_chr.1832BNL2571-260
23TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr18/D13N/AAD_chr.1834.64BNL2571-260
24GB713 x Nem-X, F2 (2011)GN-F2_chr18N/AAD_chr.1860.7BNL2571_230
25TM-1 x Hai-7124, BC1S1 (2007)TH-BC1S1_chr18N/AAD_chr.180BNL2571_260
26CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr13N/AAt.1379.92BNL2571