CIR0244, CIR0244 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	CIR0244
Alias	CIR244
Genbank ID	AJ567189
Type	SSR
Species	Gossypium hirsutum
Germplasm	Guazuncho-2
Source Sequence	AJ567189
Source Type	genomic
Repeat Motif	(TACA)4(N)2(CA)15(N)4(TA)5
PCR Condition	Annealing temperature: 55
Primer 1	CIR244_F: TGGAAGGTGATGTTCTAA
Primer 2	CIR244_R: GATCAAAGAGCAAACTAATC
Product Length	127
Polymorphism	P_ CIR0244
Publication	[view all]
Comment	Primer data obtained in 2005

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AJ567189

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
A08	chromosome	A08:123153138..123153264 +
CM018209.1	chromosome	CM018209.1:118507231..118507363 +
KI_08	chromosome	KI_08:39099531..39099721 +
A08	chromosome	A08:103026054..103026180 +
Ghir_A08	chromosome	Ghir_A08:122034778..122034902 +
A08	chromosome	A08:124490643..124490769 +
A08	chromosome	A08:124950773..124950899 +
A08	chromosome	A08:120618350..120618476 +
scaffold21128	supercontig	scaffold21128:314581..314713 -
Gbar_A08	chromosome	Gbar_A08:119238538..119238670 +
A08	chromosome	A08:120155518..120155650 +
CM017617.1	chromosome	CM017617.1:118697040..118697180 +
CM017643.1	chromosome	CM017643.1:128544097..128544213 +
CM017695.1	chromosome	CM017695.1:119380385..119380513 +
A08	chromosome	A08:126879072..126879198 +
chr04	chromosome	chr04:48527534..48527895 +
Chr04	chromosome	Chr04:66022480..66022829 +

Publications


Year	Publication
2004	Nguyen TB, Giband M, Brottier P, Risterucci AM, Lacape JM. Wide coverage of the tetraploid cotton genome using newly developed microsatellite markers. Theoretical and applied genetics. 2004 Jun; 109(1):167-75

Germplasm


Stock Name	Type
Guazuncho-2	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AJ567189	AJ567189	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	CCRI-36 x Hai-7124, F2 (2007)	AD_ch08_At.08	N/A	11.2	CIR244	View
2	Emian-22 x 3-79, BC1 (2011)	AD_ch08_At.08	N/A	5.34	CIR244	View
3	Guazuncho-2 x VH8-4602, BC1 (2005)	AD_ch08_At.08	N/A	0	CIR244	View
4	Guazuncho-2 x VH8-4602, consensus (2009)	AD_ch08_At.08	N/A	0	CIR244	View
5	Guazuncho-2 x VH8-4602, RIL (2009)	AD_ch08_At.08	N/A	0	CIR244	View
6	Handan-208 x Pima-90, F2:3 (2007)	AD_ch08_At.08	N/A	143.8	CIR244	View
7	TM-1 x 3-79, RIL (2012)	AD_ch08_At.08	N/A	136.92	CIR244	View
8	TM-1 x 3-79, RIL (2014)	AD_ch08_At.08	N/A	147.2	CIR244	View
9	JLZM x ZJXSLS, F2 (2008)	A_JZ_A13	N/A	0	CIR244-a	View
10	AD-genome wide Reference Map (2009)	AD_ch08_At.08	N/A	2	cir0244	View
11	CCRI-36 x G2005, RIL (2016)	AD_ch19_Dt.05	N/A	176.87	CIR244a	View
12	CCRI-36 x G2005, RIL (2016)	AD_ch19_Dt.05	N/A	190.57	CIR244b	View
13	TM-1 x 3-79, RIL (2012.v3)	AD_ch08_At.08	N/A	147.22	CIR244	View
14	PD 94042 x (AD)4-08, F2 (2016)	AD_ch24_Dt.08	N/A	141.3	CIR244	View

Sequence

>CIR0244 ID=CIR0244; Name=CIR0244; organism=Gossypium hirsutum; type=genetic_marker; length=127bp
TGGAAGGTGATGTTCTAAGCTGTTGTTTCAGTTGACCCTATATACATACA
TACATACATGCACACACACACACACACACACACACACACATATGTATATA
TATAGCTGATTAGTTTGCTCTTTGATC

Search form

CIR0244, CIR0244 (genetic_marker) Gossypium hirsutum