|
Marker Overview
Name | UCD_cg11135_141 |
Alias | UCcg11135_141
|
dbSNP ID | N/A |
SNP Array ID | TAMU_CottonSNP63K: | i52691Gb |
|
Type | SNP |
SNP Alleles | G/A |
5' Flanking Sequence | TCTAACTCCACCCCATTGAACCCAGGGGCT |
3' Flanking Sequence | TTTTGGATTGAATTTCCATCAACTTTTGAC |
Species | Gossypium spp. |
Source Type | EST 5' end |
Primer 1 | cg11135_F: CGAGCTATTCGGACCTCAAG |
Primer 2 | cg11135_R: TGACGATCTCTGTAAGCGGA |
Primer 3 | cg11135_F: CGAGCTATTCGGACCTCAAG |
Primer 4 | cg11135_R: TGACGATCTCTGTAAGCGGA |
Publication | [view all] |
Contact | Van Deynze, Allen Stelly, David M.
|
Comment | Primer data obtained in 2010 |
Alignments
The following features are aligned
Publications
Year | Publication |
2009 | Van Deynze A, Stoffel K, Lee M, Wilkins TA, Kozik A, Cantrell RG, Yu JZ, Kohel RJ, Stelly DM. Sampling nucleotide diversity in cotton. BMC plant biology. 2009; 9:125. |
2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>UCD_cg11135_141 ID=UCD_cg11135_141; Name=UCD_cg11135_141; organism=Gossypium spp.; type=genetic_marker; length=65bp TCTAACTCCACCCCATTGAACCCAGGGGCT[A/G]TTTTGGATTGAATTT CCATCAACTTTTGAC
|