NAU1246, NAU1246 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1246
Genbank IDBF274421
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TCTTT)5
PCR ConditionAnnealing temperature: 57
Primer 1NAU1246_F: TGCGCACTAAAGAAAAAGAA
Primer 2NAU1246_R: GAACAAAATGAATACCCCACA
Product Length191
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBF274421
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1246_FNAU1246_FGossypium arboreumprimer
NAU1246_RNAU1246_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1246NAU1246Gossypium arboreummarker_locus
NAU1246-200NAU1246-200Gossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:191957..192152 +
A02chromosomeA02:90215363..90215543 -
CM018217.1chromosomeCM018217.1:158562..158742 +
CM018203.1chromosomeCM018203.1:99688929..99689119 -
D5_02chromosomeD5_02:139179..139368 +
Chr1chromosomeChr1:137380907..137381097 -
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:290632..290822 +
Chr3chromosomeChr3:25451942..25452132 +
D10_02chromosomeD10_02:145784..145969 +
CM016615.1chromosomeCM016615.1:187374..187551 +
scaffold1977.1supercontigscaffold1977.1:148451..148646 +
scaffold2568.1supercontigscaffold2568.1:71621..71801 -
D03chromosomeD03:149318..149513 +
A02chromosomeA02:83219674..83219854 -
Ghir_D03chromosomeGhir_D03:153656..153851 +
Ghir_A02chromosomeGhir_A02:107869378..107869558 -
D03chromosomeD03:153820..154015 +
A02chromosomeA02:108063693..108063873 -
D03chromosomeD03:150645..150840 +
A02chromosomeA02:105526794..105526974 -
D03chromosomeD03:155453..155648 +
A02chromosomeA02:104108146..104108326 -
scaffold10741supercontigscaffold10741:65040..65230 +
scaffold10741supercontigscaffold10741:57077..57257 +
scaffold1758supercontigscaffold1758:178132..178312 -
Gbar_D03chromosomeGbar_D03:150712..150902 +
D03chromosomeD03:147613..147793 +
A02chromosomeA02:101920863..101921053 -
CM017625.1chromosomeCM017625.1:155778..155973 +
CM017611.1chromosomeCM017611.1:104901733..104901923 -
CM017651.1chromosomeCM017651.1:179504..179694 +
CM017637.1chromosomeCM017637.1:109701518..109701718 -
CM017703.1chromosomeCM017703.1:151881..152061 +
CM017689.1chromosomeCM017689.1:102071561..102071751 -
Sequence
>NAU1246 ID=NAU1246|Name=NAU1246|organism=Gossypium arboreum|type=genetic_marker|length=191bp
TGCGCACTAAAGAAAAAGAAGATAAATGATATCTCCTATATAGCATATAA
TATTGTTTTGGATTAAAAAGGTTTGATTTTTTACATATATGTCCATGTTT
GTATAGCAGTGAAAATCAAGAGTATTTGACTGAAGTGAAAAATTCTCTTT
TCTTTTCTTTTCTTTTCTTTTGTGGGGTATTCATTTTGTTC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_chr02N/AAD_chr.021.9NAU1246
2Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr02N/AAD_chr.02178.6NAU1246
3Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c02N/AAD_chr.02102.73NAU1246
4Guazuncho-2 x VH8-4602, RIL (2009)Guazuncho-2 x VH8-4602, RIL (2009).GV-RIL_ch02N/AAD_chr.0276.85NAU1246
5AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr02N/AAD_chr.024NAU1246
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr02N/AAt.02174.7NAU1246
7TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr02N/AAD_chr.024.5NAU1246-200
8TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr02/A2N/AAD_chr.02110.08NAU1246-200
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
46_FISH_GEN-178-1117_fig3.jpgTwo BAC translocations involving two chromosome pairs of At2 and A3 and At4 and A5 between G. arboreum and A-subgenome of G. hirsutum. [Image from Wang et al., 2008, GEN-178-1117]