NAU0935, NAU0935 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0935
AliasNAU935
Genbank IDBQ409826
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(AT)13
PCR ConditionAnnealing temperature: 57
Primer 1NAU935_F: GCCCCTTAGCTAATACAGGA
Primer 2NAU935_R: CAGGCTCCAAAATCAGGTAG
Product Length211
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ409826
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU935_FNAU935_FGossypium arboreumprimer
NAU935_RNAU935_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
micronaireqMIC.GG-RIL_ch02-2.cz12Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU935NAU935Gossypium arboreummarker_locus
NAU0935NAU0935Gossypium arboreummarker_locus
NAU0935/200yNAU0935/200yGossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D03chromosomeD03:6397112..6397309 -
A02chromosomeA02:81323244..81323451 -
CM018217.1chromosomeCM018217.1:6015749..6015948 -
CM018203.1chromosomeCM018203.1:91658113..91658322 -
D5_02chromosomeD5_02:5244022..5244219 -
KI_06chromosomeKI_06:44848504..44848704 -
Chr2chromosomeChr2:5837531..5837735 +
Chr02_CRI-A2_v1.0.a1chromosomeChr02_CRI-A2_v1.0.a1:7038723..7038925 +
Chr3chromosomeChr3:19248973..19249171 -
D10_02chromosomeD10_02:6096348..6096547 -
CM016615.1chromosomeCM016615.1:10356441..10356664 -
Dt_chr3chromosomeDt_chr3:23248373..23248570 +
At_chr3chromosomeAt_chr3:43376309..43376516 +
D03chromosomeD03:6078970..6079167 -
A02chromosomeA02:74963074..74963281 -
Ghir_D03chromosomeGhir_D03:6178240..6178437 -
Ghir_A02chromosomeGhir_A02:99209286..99209493 -
D03chromosomeD03:6051473..6051670 -
A02chromosomeA02:99679401..99679608 -
D03chromosomeD03:6207485..6207682 -
D03chromosomeD03:6045040..6045237 -
A02chromosomeA02:95487978..95488185 -
At02chromosomeAt02:79900853..79901062 -
scaffold7345supercontigscaffold7345:117303..117516 +
scaffold7345supercontigscaffold7345:108617..108816 +
scaffold10688supercontigscaffold10688:73616..73825 -
Gbar_D03chromosomeGbar_D03:6056561..6056760 -
Gbar_A02chromosomeGbar_A02:91752732..91752941 -
D03chromosomeD03:6201073..6201272 -
A02chromosomeA02:93790910..93791119 -
CM017625.1chromosomeCM017625.1:6104325..6104524 -
CM017611.1chromosomeCM017611.1:95618176..95618383 -
CM017651.1chromosomeCM017651.1:6296081..6296280 -
CM017637.1chromosomeCM017637.1:100904535..100904740 -
CM017703.1chromosomeCM017703.1:6175331..6175530 -
CM017689.1chromosomeCM017689.1:93598555..93598762 -
Sequence
>NAU0935 ID=NAU0935|Name=NAU0935|organism=Gossypium arboreum|type=genetic_marker|length=211bp
GCCCCTTAGCTAATACAGGAATCATATATATATATATATATATATATATA
CATAGATCAACTAAAAATCTACATCAAAATTTACCCAGAGAAGGAAAAAA
AAAAGTATAGTACTTCAGAACAATCTGTGTAAGCTATTATCATGTAGTGC
AGATAATAAGAAAATCATCTCTTCATCACTTCCATCATACTCTACCTGAT
TTTGGAGCCTG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A09N/AA_chr.09100.8NAU935View
2GX1135 x GX100-2, F2 (2013)GG-F2_chr02-1N/AAD_chr.0264.4NAU935View
3GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.0293.6NAU935View
4GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.0294.3NAU935View
5Yumian-1 x T586, RIL (2006)YT-RIL_chr02-2N/AAD_chr.0222.7NAU0935View
6(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr02-2N/AAD_chr.0218.3NAU0935View
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr02N/AAD_chr.0283.9NAU0935View
8Yumian-1 x 7235, RIL (2015)Y7-RIL_chr02N/AAD_chr.0265.8NAU0935View
9Yumian-1 x T586, RIL (2009)YT-RIL_chr02-1N/AAD_chr.0270.5NAU0935/200yView