JESPR0191, JESPR0191 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	JESPR0191
Alias	JESPR191
Genbank ID	AF351429
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	AF351429.1
Source Type	genomic
Repeat Motif	(GAA)10
Primer 1	JESPR0191_F: GGTCTAGCCTTTCGGAATTTG
Primer 2	JESPR0191_R: GAATCATTCTCGTTCTCGGAC
Publication	[view all]
Comment	Primer data obtained in 2002

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AF351429

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Dt_chr3	chromosome	Dt_chr3:21269522..21269594 +	Gossypium hirsutum (AD1) 'TM-1' genome CGP-BGI_v1	n/a
A03	chromosome	A03:5681798..5681870 -	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	n/a
Ghir_D03	chromosome	Ghir_D03:45842288..45842357 +	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
Ghir_A03	chromosome	Ghir_A03:7522144..7522216 -	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
A03	chromosome	A03:7082413..7082485 -	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
A03	chromosome	A03:7471652..7471724 -	Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1	n/a
A03	chromosome	A03:6887302..6887374 -	Gossypium hirsutum (AD1) 'ZM24' genome CRI_v1	n/a
scaffold4553	supercontig	scaffold4553:574827..574896 -	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
scaffold18688	supercontig	scaffold18688:15642..15708 -	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
A03	chromosome	A03:6842954..6843026 -	Gossypium barbadense (AD2) 'H7124' genome ZJU_v1.1_a1	n/a
A03	chromosome	A03:7572803..7572875 -	Gossypium hirsutum (AD1) 'TM-1' genome UTX_v2.1	n/a
Chr03	chromosome	JESPR0191:1..393 . Chr03:39662013..39662399 +		n/a
Chr10	chromosome	JESPR0191:1..393 . Chr10:14472543..14472929 +		n/a

Publications


Year	Publication
2001	Reddy O, Pepper A, Abdurakhmonov I, Saha S, Jenkins J, Brooks T, Bolek Y, El-Zik K. New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. Journal of cotton science. 2001; 5(2):103-113

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AF351429.1	AF351429.1	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Acala-44 x Pima S-7, F2 (2004)	AD_chU	N/A	2.7	JESPR191	View
2	TM-1 x 3-79, RIL (2012)	AD_ch03_At.03	N/A	85.67	JESPR191	View
3	Yumian-1 x T586, RIL (2006)	AD_ch03_At.03	N/A	64.1	JESPR191	View
4	Yumian-1 x T586, RIL (2015)	AD_ch03_At.03	N/A	84.5	JESPR191	View
5	TM-1 x 3-79, RIL (2014)	AD_ch03_At.03	N/A	30.7	JESPR191	View
6	Monsanto SSR Bin Map, (2009)	AD_ch03_At.03	N/A	61	JESPR191	View
7	Yumian-1 x T586, RIL (2009)	AD_chU	N/A	7.9	JESPR191/80y	View
8	TM-1 x 3-79, RIL (2012.v3)	AD_ch03_At.03	N/A	30.7	JESPR191	View

Sequence

>JESPR0191 ID=JESPR0191; Name=JESPR0191; organism=Gossypium hirsutum; type=genetic_marker; length=76bp
GGTCTAGCCTTTCGGAATTTGAAGAAGAAGAAGAAGAAGAAGAAGAAGAA
GATGAGTCCGAGAACGAGAATGATTC

Search form

JESPR0191, JESPR0191 (genetic_marker) Gossypium hirsutum