JESPR0180, JESPR0180 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	JESPR0180
Alias	JESPR180
Genbank ID	AF351418
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	AF351418.1
Source Type	genomic
Repeat Motif	(GA)5(GA)20
Primer 1	JESPR0180_F: GCGTAGTACATATAGATGCCC
Primer 2	JESPR0180_R: CTTGGAGTATGTATGCTCTATTC
Publication	[view all]
Comment	Primer data obtained in 2002

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AF351418

Publications


Year	Publication
2001	Reddy O, Pepper A, Abdurakhmonov I, Saha S, Jenkins J, Brooks T, Bolek Y, El-Zik K. New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. Journal of cotton science. 2001; 5(2):103-113

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AF351418.1	AF351418.1	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Acala-44 x Pima S-7, F2 (2004)	AD_ch09_At.09	N/A	91.1	JESPR180	View
2	Handan-208 x Pima-90, F2:3 (2007)	AD_ch07_At.07	N/A	97.9	JESPR180	View
3	TM-1 x 3-79, RIL (2012)	AD_ch15_Dt.01	N/A	68.22	JESPR180	View
4	Emian-22 x 3-79, BC1 (2011)	AD_ch15_Dt.01	N/A	115.05	JESPR180	View
5	TM-1 x 3-79, RIL (2014)	AD_ch15_Dt.01	N/A	51.7	JESPR180	View
6	TM-1 x (TX-0256 + TX-1046), CSIL (2016)	AD_ch15_Dt.01	N/A	74.2	JESPR180	View
7	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch15_Dt.01	N/A	74.3	JESPR180	View
8	Monsanto SSR Bin Map, (2009)	AD_ch15_Dt.01	N/A	41	JESPR180	View
9	CCRI-36 x Hai-7124, F2 (2007)	AD_ch15_Dt.01	N/A	87.6	JESP180	View
10	AD-genome wide Reference Map (2009)	AD_ch15_Dt.01	N/A	71	jespr0180	View
11	TM-1 x Hai-7124, BC1 (2007)	AD_ch15_Dt.01	N/A	66.3	JESPR180-95	View
12	TM-1 x Hai-7124, BC1 (2008)	AD_ch15_Dt.01	N/A	65.06	JESPR180-95	View
13	Vsg x (TM-1 x Hai-7124), DH (2005)	AD_ch15_Dt.01	N/A	2.2	JESPR180-95	View
14	TM-1 x Hai-7124, BC1 (2012)	AD_ch15_Dt.01	N/A	59.7	JESPR180-95	View
15	Xinluzao-1 x Hai-7124, F2 (2008)	AD_ch15_Dt.01	N/A	51.5	JESPR180-2	View
16	Xinluzao-1 x Hai-7124, F2 (2008)	AD_ch15_Dt.01	N/A	54.2	JESPR180-1	View
17	TM-1 x 3-79, RIL (2012.v3)	AD_ch15_Dt.01	N/A	51.68	JESPR180	View

Sequence

>JESPR0180 ID=JESPR0180; Name=JESPR0180; organism=Gossypium hirsutum; type=genetic_marker; length=97bp
GCGTAGTACATATAGATGCCCTCGTGTTAAAGAGAGAGAGAGAGAGAGAA
GAAGAAGAAGAAGAAGAAGAAGAAGAATAGAGCATACATACTCCAAG

Search form

JESPR0180, JESPR0180 (genetic_marker) Gossypium hirsutum