Gh478, Gh478 (genetic_marker) Gossypium hirsutum

Marker Overview
NameGh478
Genbank IDDQ908417
TypeSSR
SpeciesGossypium hirsutum
GermplasmTamcot Sphinx
Source SequenceDQ908417
Source Typegenomic
Repeat MotifTCT(10)
Primer 1Gh478_F: TTCAATTCTGATTCTAACGCCATCAG
Primer 2Gh478_R: AGAATCGATGAGACACATGCTGAG
Publication[view all]
CommentPrimer data obtained in 2008-01 from Hoffman, Steve M.
Germplasm
Stock NameType
Tamcot Sphinxcultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDQ908417
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Gh478_FGh478_FGossypium hirsutumprimer
Gh478_RGh478_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GH478GH478Gossypium hirsutummarker_locus
GH478GH478-65.491Gossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DQ908417DQ908417Gossypium hirsutumsequence_feature


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D06chromosomeD06:17981273..17981369 +
A05chromosomeA05:35453017..35453122 +
CM018206.1chromosomeCM018206.1:34488822..34488918 +
Chr10chromosomeChr10:78018178..78018271 +
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:35475392..35475485 +
Dt_chr9chromosomeDt_chr9:38387877..38387982 -
Dt_chr10chromosomeDt_chr10:14734604..14734700 -
D06chromosomeD06:17231998..17232094 +
A05chromosomeA05:32295247..32295352 +
Ghir_D06chromosomeGhir_D06:17704669..17704765 +
Ghir_D05chromosomeGhir_D05:29714766..29714850 +
Ghir_D03chromosomeGhir_D03:18743577..18743661 +
Ghir_A05chromosomeGhir_A05:34415872..34415977 +
Ghir_D10chromosomeGhir_D10:43335853..43335934 -
Ghir_D02chromosomeGhir_D02:65641721..65641802 -
D06chromosomeD06:17223242..17223338 +
A05chromosomeA05:34162013..34162118 +
D06chromosomeD06:17685099..17685195 +
A05chromosomeA05:35364633..35364738 +
D06chromosomeD06:17209180..17209276 +
A05chromosomeA05:34428861..34428966 +
Dt02chromosomeDt02:66351635..66351716 -
Dt02chromosomeDt02:66347341..66347422 -
scaffold5239supercontigscaffold5239:73534..73615 -
scaffold5239supercontigscaffold5239:69240..69321 -
scaffold3839supercontigscaffold3839:956487..956571 -
scaffold1745supercontigscaffold1745:195506..195599 -
scaffold14780supercontigscaffold14780:285461..285557 -
scaffold1461supercontigscaffold1461:331110..331194 -
scaffold10009supercontigscaffold10009:116645..116729 -
Gbar_D05chromosomeGbar_D05:29406727..29406811 +
Gbar_A05chromosomeGbar_A05:33319038..33319134 +
Gbar_D09chromosomeGbar_D09:38372178..38372271 -
Gbar_D03chromosomeGbar_D03:16726374..16726458 -
Gbar_D02chromosomeGbar_D02:63506028..63506109 -
A05chromosomeA05:34895081..34895177 +
CM017628.1chromosomeCM017628.1:17489295..17489385 +
CM017614.1chromosomeCM017614.1:34469401..34469497 +
CM017640.1chromosomeCM017640.1:35643634..35643733 +
CM017692.1chromosomeCM017692.1:34700716..34700812 +
Sequence
>Gh478 ID=Gh478|Name=Gh478|organism=Gossypium hirsutum|type=genetic_marker|length=97bp
TTCAATTCTGATTCTAACGCCATCAGAGTTTCCTCCTCCTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCTTCACCTCAGCATGTGTCTCATCGATTCT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1TM-1 x 3-79, RIL (2012)TM-1 x 3-79, RIL (2012).T3-RIL.12_c25N/AAD_chr.2571.94GH478View
2TM-1 x 3-79, RIL (2014)T3-RIL.14_chr25N/AAD_chr.2565.5GH478View
30-153 x sGK9708, RIL (2015)0s-RIL.15_chr25N/AAD_chr.2526.83GH478View
40-153 x sGK9708, RIL (2016)0s-RIL_chr25-1N/AAD_chr.25156.9GH478View
5TM-1 x 3-79, RIL (2012.v3)T3-RIL.12v3_chr.25N/AAD_chr.2565.49GH478View