Gh055, Gh055 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	Gh055
Alias	Gh55
Genbank ID	DQ907997
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	DQ907997
Source Type	genomic
Repeat Motif	TCT(16)
Primer 1	Gh055_F: GAATCACGGTTGGCATCTC
Primer 2	Gh055_R: GCACCAATTTAGGGTTTAGGC
Publication	[view all]
Comment	Primer data obtained in 2008-01 from Hoffman, Steve M.

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	DQ907997

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
D13	chromosome	D13:53869885..53870052 -	Gossypium hirsutum (AD1) 'TM-1' genome UTX-JGI-Interim-release_v1.1	n/a
CM018227.1	chromosome	CM018227.1:49843777..49843935 -	Gossypium barbadense (AD2) '3-79' genome HGS_v1.1	n/a
Dt_chr13	chromosome	Dt_chr13:19524320..19524487 +	Gossypium hirsutum (AD1) 'TM-1' genome CGP-BGI_v1	n/a
D13	chromosome	D13:49656828..49657010 -	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	n/a
Ghir_A13	chromosome	Ghir_A13:11281660..11281770 +	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
Ghir_D13	chromosome	Ghir_D13:52834918..52835085 -	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
D13	chromosome	D13:53950991..53951158 -	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
D13	chromosome	D13:53000651..53000818 -	Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1	n/a
D13	chromosome	D13:49926395..49926562 -	Gossypium hirsutum (AD1) 'ZM24' genome CRI_v1	n/a
Dt13	chromosome	Dt13:52283259..52283642 -	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
scaffold15155	supercontig	scaffold15155:61331..61714 -	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
Gbar_D13	chromosome	Gbar_D13:49520937..49521095 -	Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1	n/a
D13	chromosome	D13:50890367..50890528 -	Gossypium barbadense (AD2) 'H7124' genome ZJU_v1.1_a1	n/a
CM017635.1	chromosome	CM017635.1:50531425..50531568 -	Gossypium tomentosum (AD3) genome HGS_v1.1	n/a
CM017661.1	chromosome	CM017661.1:53818257..53818424 -	Gossypium mustelinum (AD4) genome JGI_v1.1	n/a
D13	chromosome	D13:54030968..54031135 -	Gossypium hirsutum (AD1) 'TM-1' genome UTX_v2.1	n/a
Chr13	chromosome	Chr13:33963695..33964171 -	Gossypium aridum (D4) genome ISU_v1	n/a
Chr04	chromosome	Gh055:1..551 . Chr04:39672882..39673250 +		n/a

Publications


Year	Publication
2007	Hoffman S, Yu J, Grum D, Xiao J, Kohel R, Pepper A. Identification of 700 New Microsatellite Loci from Cotton (G. hirsutum L.). Journal of cotton science. 2007; 11(4):208-241

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
DQ907997	DQ907997	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Emian-22 x 3-79, BC1 (2011)	AD_ch07_At.07	N/A	49.7	Gh055e	View
2	Emian-22 x 3-79, BC1 (2011)	AD_ch12_At.12	N/A	83.57	Gh055f	View
3	Emian-22 x 3-79, BC1 (2011)	AD_ch13_At.13	N/A	141.71	Gh055c	View
4	Emian-22 x 3-79, BC1 (2011)	AD_ch16_Dt.07	N/A	54.43	Gh055b	View
5	Emian-22 x 3-79, BC1 (2011)	AD_ch16_Dt.07	N/A	70.41	Gh055d	View
6	Emian-22 x 3-79, BC1 (2011)	AD_ch18_Dt.13	N/A	57.3	Gh055a	View
7	Emian-22 x 3-79, BC1 (2011)	AD_ch26_Dt.12	N/A	17.44	Gh055g	View
8	TM-1 x 3-79, RIL (2012)	AD_ch18_Dt.13	N/A	62.44	GH055	View
9	Yumian-1 x T586, RIL (2015)	AD_ch07_At.07	N/A	72.5	GH055	View
10	TM-1 x 3-79, RIL (2014)	AD_ch18_Dt.13	N/A	63.4	GH055	View
11	Emian-22 x 3-79, BC1 (2015)	AD_ch26_Dt.12	N/A	131.7	Gh55g	View
12	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch18_Dt.13	N/A	87.6	GH55	View
13	TM-1 x 3-79, RIL (2012.v3)	AD_ch18_Dt.13	N/A	63.45	GH055	View

Sequence

>Gh055 ID=Gh055; Name=Gh055; organism=Gossypium hirsutum; type=genetic_marker; length=168bp
GAATCACGGTTGGCATCTCTATTTTTTCTCTTCTCCTTCTTCTTCTTCTC
CTCCTCTTCCTCCTCCTCTTCTTTTTATTCTTCTTCTTCTTCCTCTTCTT
CTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTGCC
TAAACCCTAAATTGGTGC

Search form

Gh055, Gh055 (genetic_marker) Gossypium hirsutum