NAU6326, NAU6326 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU6326
Genbank IDAC193495
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Acala Maxxa
Source Typegenomic
Repeat MotifATT(8)
Primer 1NAU6326_F: CATTGGCCCTTATTTTGTTT
Primer 2NAU6326_R: GCCCACTGTAACTTGGACTC
Publication[view all]
ContactZhang, Tian-Zhen
Germplasm
Stock NameType
Acala Maxxacultivar
Acala Maxxacultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAC193495
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU6326_FNAU6326_FGossypium hirsutumprimer
NAU6326_RNAU6326_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU6326NAU6326Gossypium hirsutummarker_locus
NAU6326-400NAU6326-400Gossypium hirsutummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr16N/AAD_chr.1644.38NAU6326View
2H16 x T586, F2sel (2009)H16T586-F2sel_chr16N/AAD_chr.1665.3NAU6326View
3TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr16N/AAD_chr.1649NAU6326View
4TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr16/D1N/AAD_chr.1678.1NAU6326-400View
5H16 x T586, F2 (2009)H16T586-F2_chr16N/AAD_chr.1677.8NAU6326-400View