NAU1071, NAU1071 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU1071
Genbank IDBQ402528
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TTC)10
PCR ConditionAnnealing temperature: 57
Primer 1NAU1071_F: ACCAACAATGGTGACCTCTT
Primer 2NAU1071_R: CCCTCCATAACCAAAAGTTG
Product Length173
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ402528
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU1071_FNAU1071_FGossypium arboreumprimer
NAU1071_RNAU1071_RGossypium arboreumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.TTT-CSIL_ch03.p1-df12.2Gossypium hirsutumQTL
seed cotton weight per bollqBWT.TTT-CSIL_ch03.p1-nj14.2Gossypium hirsutumQTL
seed cotton weight per bollqBWT.TTT-CSIL_ch03.p1-sy15.3Gossypium hirsutumQTL
lint percentqLP.TTT-CSIL_ch03.p1-df12.3Gossypium hirsutumQTL
lint percentqLP.TTT-CSIL_ch03.p1-nj13.3Gossypium hirsutumQTL
lint percentqLP.TTT-CSIL_ch03.p1-nj14Gossypium hirsutumQTL
lint percentqLP.TTT-CSIL_ch03.p1-sy15.3Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch03.p1-nj13Gossypium hirsutumQTL
seed indexqSI.TTT-CSIL_ch03.p1-sy15Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU1071NAU1071Gossypium arboreummarker_locus
NAU1071aNAU1071aGossypium arboreummarker_locus
NAU1071bNAU1071bGossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Chr5chromosomeNAU1071:1..656 .
Chr5:38609350..38609998 -
Chr05chromosomeNAU1071:1..656 .
Chr05:58987191..58987839 +
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
17235 x TM-1, RIL (2007)7235 x TM-1, RIL (2007).7T-RIL_A03N/AAD_chr.0335.1NAU1071
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr03N/AAD_chr.03161NAU1071
37235 x TM-1, F2:3 (2005)7T-F2:3_chr03N/AAD_chr.0366.5NAU1071
4HS427-10 x TM-1, F2:3 (2005)HT-F2:3_chr03-1N/AAD_chr.0340.2NAU1071
5PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr03-1N/AAD_chr.0321.4NAU1071
60-153 x sGK9708, RIL (2016)0s-RIL_chr03-2N/AAD_chr.0364.5NAU1071
7CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0374.1NAU1071
80-153 x sGK9708, RIL (2017)0s-RIL.17_chr03N/AAD_chr.031.95NAU1071
9TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.03101.6NAU1071a
10TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr14-2N/AAD_chr.1417.8NAU1071b