BNL1421, BNL1421 (genetic_marker) Gossypium hirsutum

Marker Overview
NameBNL1421
Genbank IDN/A
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source Typegenomic
Repeat Motif(AG)29, (AG)14
PCR ConditionAnnealing temperature: 55
Primer 1BNL1421_F: TGAAGATTTGGAGGCAATTG
Primer 2BNL1421_R: GAAATCAAGCCTCAATTCGG
PolymorphismP_ BNL1421
CommentPrimer data obtained in 2000
Germplasm
Stock NameType
Deltapine 90obsolete_cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
BNL1421_FBNL1421_FGossypium hirsutumprimer
BNL1421_RBNL1421_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BNL1421BNL1421Gossypium hirsutummarker_locus
BNL1421-157BNL1421-157Gossypium hirsutummarker_locus
BNL1421-192BNL1421-192Gossypium hirsutummarker_locus
BNL1421-195BNL1421-195Gossypium hirsutummarker_locus
NBNL1421NBNL1421Gossypium hirsutummarker_locus
BNL1421BNL1421-59.5Gossypium hirsutummarker_locus


Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1CCRI-36 x Hai-7124, F2 (2007)CCRI-36 x Hai-7124, F2 (2007).CH-F2_A01N/AAD_chr.13100.8BNL1421View
2Guazuncho-2 x VH8-4602, consensus (2009)Guazuncho-2 x VH8-4602, consensus (2009).GV-cons_c13N/AAD_chr.13108.33BNL1421View
3Monsanto SSR Bin Map, (2009)Monsanto SSR Bin Map, (2009).BIN-SSR_chr13N/AAD_chr.13110BNL1421View
4TM-1 x 3-79, RIL (2006)TM-1 x 3-79, RIL (2006).T3-RIL_chr.18bN/AAD_chr.1829.5BNL1421View
5Guazuncho-2 x VH8-4602, BC1 (2005)Guazuncho-2 x VH8-4602, BC1 (2005).GV-BC1_chr13/lgA01N/AAD_chr.13163.5BNL1421View
6AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr13N/AAD_chr.13119BNL1421View
7PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr13/LGA01N/AAD_chr.1324.3BNL1421View
80-153 x sGK9708, RIL (2016)0s-RIL_chr13N/AAD_chr.1317.9BNL1421View
9CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr13N/AAt.13107.1BNL1421View
100-153 x sGK9708, RIL (2017)0s-RIL.17_chr13N/AAD_chr.13121.44BNL1421View
11HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr13N/AAD_chr.130BNL1421-157View
12HS-46 x MARCABUCAG8US-1-88, RIL (2009)HS-46 x MARCABUCAG8US-1-88, RIL (2009).HSM-RIL_chr13N/AAD_chr.131BNL1421-192View
13Vsg x (TM-1 x Hai-7124), DH (2005)Vsg x (TM-1 x Hai-7124), DH (2005).VTH-DH.05_lgA01N/AAD_chr.1349.6BNL1421-195View
14TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr13N/AAD_chr.1370.6BNL1421-195View
15TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr13/A13N/AAD_chr.1370.85BNL1421-195View
16H18 x TM-1, F2 (2005)H18TM1-F2_chr13N/AAD_chr.1351.3NBNL1421View
17PD 94042 x (AD)4-08, F2 (2016)PA-F2_chr13N/AAt.1359.5BNL1421View