|
Marker Overview
Name | TAMU_GH_TBh046C04f766 |
dbSNP ID | N/A |
SNP Array ID | TAMU_CottonSNP63K: | i39896Gh |
|
Type | SNP |
SNP Alleles | A/G |
Species | Gossypium sp. |
Publication | [view all] |
Contact | Stelly, David M.
|
Comment | sequence data obtained from TAMU CottonSNP63K Array |
Alignments
The following features are aligned
Publications
Year | Publication |
2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>TAMU_GH_TBh046C04f766 ID=TAMU_GH_TBh046C04f766; Name=TAMU_GH_TBh046C04f766; organism=Gossypium sp.; type=genetic_marker; length=79bp GGGACTACCTTTGTCCCTAATTATCTTTTTGAGTTTTTTTGACTCTTTCG [A/G]GTTTCATTTAATTTTTCCTCCACT
|