|
Alignments
The following features are aligned
Publications
Year | Publication |
2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
2014 | Gore MA, Fang DD, Poland JA, Zhang J, Percy RG, Cantrell RG, Thyssen G, and Lipka AE. Linkage Map Construction and Quantitative Trait Locus Analysis of Agronomic and Fiber Quality Traits in Cotton. The Plant Genome. 2014 Mar; 7(1):1-10. |
Sequence
>USDA_SNP0020 ID=USDA_SNP0020; Name=USDA_SNP0020; organism=Gossypium hirsutum; type=genetic_marker; length=67bp TGCAGAATGTC[A/C]TTTTCTCGATCCCTCGGTCTTTGGCATGTGACTT TCAAGAGAGCAGTAATT
|