|
|
Marker Overview
| Name | USDA_CFB2819 |
|---|
| Alias | CFB2819
|
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | TAMU_CottonSNP63K: | i21369Gh |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | A/G |
|---|
| 5' Flanking Sequence | TTCATGCATTGTTACT |
|---|
| 3' Flanking Sequence | TAAGTGACTAATTGACTAGGGATTACAAAATAATGGAAGCTTATAACTTCAATTAATGCA
ACACTGGCA |
|---|
| Species | Gossypium hirsutum |
|---|
| Publication | [view all] |
|---|
| Contact | Fang, David D.
Stelly, David M.
|
|---|
| Comment | SNP generated in Data2Bio, LLC, Ames, IA |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2015 | Islam MS, Thyssen GN, Jenkins JN, and Fang DD. Detection, Validation, and Application of Genotyping-by-Sequencing Based Single Nucleotide Polymorphisms in Upland Cotton. The Plant Genome. 2015 March; 8(1):1-10. |
| 2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>USDA_CFB2819 ID=USDA_CFB2819; Name=USDA_CFB2819; organism=Gossypium hirsutum; type=genetic_marker; length=90bp
TTCATGCATTGTTACT[A/G]TAAGTGACTAATTGACTAGGGATTACAAA
ATAATGGAAGCTTATAACTTCAATTAATGCAACACTGGCA
|
