SHIN-0219, SHIN-0219 (genetic_marker) Gossypium hirsutum

Marker Overview
NameSHIN-0219
Genbank IDAI055717
TypeSSR
SpeciesGossypium hirsutum
GermplasmAcala Maxxa
Source SequenceAI055717.1
Source TypeEST
Primer 1SHIN-0219_F: CAAACACCGTTTCAAGCTCA
Primer 2SHIN-0219_R: TACGGCAGAAATTGTCACGA
Restriction EnzymeEcoRI; XhoI
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
Germplasm
Stock NameType
Acala Maxxacultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankAI055717
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
SHIN-0219_FSHIN-0219_FGossypium hirsutumprimer
SHIN-0219_RSHIN-0219_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
AI055717.1AI055717.1Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SHIN0219SHIN0219Gossypium hirsutummarker_locus


Contact
NameDetails
Monsanto
Country:United States
Sequence
>SHIN-0219 ID=SHIN-0219|Name=SHIN-0219|organism=Gossypium hirsutum|type=genetic_marker|length=245bp
CAAACACCGTTTCAAGCTCATCTCTTCTTCTTCTTCTTCTTCTTGCGGTA
AAGCTTTTGCTCAATCTGAAGGAAAAGAAGGGGGAGTTAAAGAGGAAGAC
CCTCCCGCTTTCTCTGGTTCATTGTCTTCCACACGCACACAGCTCGATCT
TTTGGACCAGCTTAGTTCAACGAGCTTCACTGGCCACCGGGTTTAAAAGT
AACGGTGGGTTTGGGAACTCACGATTCGTGACAATTTCTGCCGTA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1GX1135 x GX100-2, F2 (2013)GG-F2_chr13N/AAD_chr.130SHIN0219View
2GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr02-2N/AAD_chr.0219.8SHIN0219View
3GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr02-2N/AAD_chr.0219.8SHIN0219View