NAU3823, NAU3823 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU3823
Genbank IDCO121300
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(at)7
PCR ConditionAnnealing temperature: 57
Primer 1NAU3823_F: AGAAAAGCGCTGCTGATAGT
Primer 2NAU3823_R: GCTGACAAAGTCTATCCTAAAA
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO121300
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU3823_FNAU3823_FGossypium raimondiiprimer
NAU3823_RNAU3823_RGossypium raimondiiprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU3823NAU3823Gossypium raimondiimarker_locus
NAU3823NAU3823-17.309Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:3224850..3225050 +
A05chromosomeA05:3583026..3583234 +
CM018219.1chromosomeCM018219.1:3011269..3011473 +
CM018206.1chromosomeCM018206.1:3542651..3542855 +
D5_05chromosomeD5_05:2832539..2832741 +
KI_05chromosomeKI_05:2594780..2594977 +
Chr9chromosomeChr9:57284272..57284486 -
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:3467792..3468006 +
Chr9chromosomeChr9:3809788..3809990 -
D10_05chromosomeD10_05:57666128..57666326 -
CM016626.1chromosomeCM016626.1:4955216..4955418 +
Dt_chr9chromosomeDt_chr9:66326788..66326988 -
At_chr9chromosomeAt_chr9:50754656..50754884 -
scaffold1240_A05supercontigscaffold1240_A05:59401..59609 +
D05chromosomeD05:3064001..3064201 +
Ghir_D05chromosomeGhir_D05:3199535..3199735 +
Ghir_A05chromosomeGhir_A05:3583278..3583491 +
D05chromosomeD05:2999711..2999911 +
A05chromosomeA05:3458608..3458816 +
D05chromosomeD05:3109737..3109937 +
A05chromosomeA05:3557394..3557602 +
D05chromosomeD05:2970039..2970239 +
A05chromosomeA05:3961932..3962140 +
scaffold3667supercontigscaffold3667:33108..33312 +
scaffold10000supercontigscaffold10000:477891..478095 -
Gbar_D05chromosomeGbar_D05:3100430..3100634 +
Gbar_A05chromosomeGbar_A05:3232114..3232318 +
D05chromosomeD05:3251478..3251682 +
A05chromosomeA05:3713288..3713492 +
CM017627.1chromosomeCM017627.1:3081383..3081581 +
CM017614.1chromosomeCM017614.1:3544946..3545148 +
CM017653.1chromosomeCM017653.1:3247069..3247269 +
CM017640.1chromosomeCM017640.1:3609777..3609979 +
CM017705.1chromosomeCM017705.1:3072596..3072802 +
CM017692.1chromosomeCM017692.1:3510230..3510432 +
Sequence
>NAU3823 ID=NAU3823|Name=NAU3823|organism=Gossypium raimondii|type=genetic_marker|length=206bp
AGAAAAGCGCTGCTGATAGTGTTCCATTGGAGCACATCACCCGTATTTTC
CCCATTCTTGGTTAAGCCTCTAGCTGGGATGAACACTTTTTTGGAGTTAT
TTGTGCCATGTTTTCGTTGACATTGCGACCATTCTCTTTGTTTTTTTGTC
TTGGATATATATATATATAACTGAGAAACAGCTATTTTAGGATAGACTTT
GTCAGC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part(Simian-3 x Sumian-12) x (Zhong-4133 x 8891), 4WC (2008) part.SSZ8-4WC_D05-1N/AAD_chr.1914.4NAU3823View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr19N/AAD_chr.1947NAU3823View
3Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-1N/AAD_chr.057.9NAU3823View
4(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr19-2N/AAD_chr.1933.5NAU3823View
5Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.0544.7NAU3823View
60-153 x sGK9708, RIL (2016)0s-RIL_chr19-2N/AAD_chr.1922.8NAU3823View
7CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr05N/AAD_chr.05119.9NAU3823View
8CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr05N/AAt.0517.31NAU3823View