NAU2096, NAU2096 (genetic_marker) Gossypium hirsutum

Marker Overview
NameNAU2096
Genbank IDDR044182
TypeSSR
SpeciesGossypium hirsutum
Germplasm7235
7235
Source SequenceDR044182.1
Source TypeEST
Repeat MotifTGG(6)
PCR ConditionAnnealing temperature: 57
Primer 1NAU2096_F: GAGAGATAAACGGAGGTGGA
Primer 2NAU2096_R: TTAGTCAAACCGAGCAGCTT
Product Length212
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
7235breeding_germplasm
7235breeding_germplasm
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankDR044182
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2096_FNAU2096_FGossypium hirsutumprimer
NAU2096_RNAU2096_RGossypium hirsutumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2096NAU2096Gossypium hirsutummarker_locus
NAU2096-200NAU2096-200Gossypium hirsutummarker_locus
NAU2096bNAU2096bGossypium hirsutummarker_locus


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
DR044182.1DR044182.1Gossypium hirsutumsequence_feature


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU2096 ID=NAU2096|Name=NAU2096|organism=Gossypium hirsutum|type=genetic_marker|length=212bp
GAGAGATAAACGGAGGTGGATCTTTAGTGAAACAAGATACAAGTCCTGTG
AAGAGTGTAGGTAATAATGGTGGTGGTGGTGGTGGTGCAAGTACGGCAGC
AGCGGAGAAAAGTGCATGCTATTGCTTGTGGCGTGTGGCTAAANGCAGCG
AGAAGCTGAAGCTGCAGGTGGCGACTGCAGAAGCAGCTTTACAAGCTGCT
CGGTTTGACTAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr12N/AAD_chr.1286.2NAU2096
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr12N/AAD_chr.12139NAU2096
3Emian-22 x 3-79, BC1 (2015)E3-BC1-2015_chr12N/AAD_chr.12139.1NAU2096
4TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr12N/AAD_chr.1231.9NAU2096-200
5TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr12/A12N/AAD_chr.1268.51NAU2096-200
6CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr12N/AAt.12107.4NAU2096b
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]
46_FISH_GEN-178-1117_fig3.jpgTwo BAC translocations involving two chromosome pairs of At2 and A3 and At4 and A5 between G. arboreum and A-subgenome of G. hirsutum. [Image from Wang et al., 2008, GEN-178-1117]
48_FISH_TAG-115-675.jpgTwenty-six individual cotton mitotic chromosomes with FISH signals derived from the chromosome-speciWc BACs, and comparisons of linkage and FISH maps. [Image from Wang 2007, TAG-115-675]