NAU0997, NAU0997 (genetic_marker) Gossypium arboreum

Marker Overview
NameNAU0997
AliasNAU997
Genbank IDBQ406381
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8400
AKA 8400
Source TypeEST
Repeat Motif(TC)9
PCR ConditionAnnealing temperature: 57
Primer 1NAU997_F: TATGAACCAAAAGCCCTGAC
Primer 2NAU997_R: GTGTGTTTTTGGGATGTGAA
Product Length239
Restriction EnzymeEcoRI; XhoI
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Germplasm
Stock NameType
AKA 8400cultivar
AKA 8400cultivar
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankBQ406381
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU997_FNAU997_FGossypium arboreumprimer
NAU997_RNAU997_RGossypium arboreumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU997NAU997Gossypium arboreummarker_locus
NAU0997NAU0997Gossypium arboreummarker_locus
NAU0997/200yNAU0997/200yGossypium arboreummarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU0997 ID=NAU0997|Name=NAU0997|organism=Gossypium arboreum|type=genetic_marker|length=239bp
TATGAACCAAAAGCCCTGACCCCGAAATCCAAAGCCGAAGTCTCTCTCTC
TCTCTCTCACACACGCACTCACTCCGTCTCTCATGTCATGTCATGTCATG
CAAGTAGCACCTAAGCTTTTAAGTTTTTAACCCCTCTCTGCGCTCTCTCT
CTCTCTCTCTCTCACACACACTCCCTTCACCCCACGACATTTGTTTAATT
GTGTCACTTGGCCAGCTCATTCACATCCCAAAAACACAC
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch03/A03N/AAD_chr.030NAU997
2PD6992 x SM3, F2:3 (2005)PDSM-F2:3_chr03-1N/AAD_chr.0317.3NAU997
3TM-1 x (TX-0256 + TX-1046), CSIL (2016)TTT-CSIL_chr03N/AAD_chr.0398NAU997
4CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr03N/AAt.0376.9NAU997
5CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr14N/ADt.02101.3NAU997
6Yumian-1 x T586, RIL (2006)YT-RIL_chr14-3N/AAD_chr.1462.6NAU0997
7Yumian-1 x T586, RIL (2015)YT-RIL.15_chr14N/AAD_chr.14113.1NAU0997
8Yumian-1 x T586, RIL (2009)YT-RIL_chr14-1N/AAD_chr.1430.1NAU0997/200y