MUSS0193, MUSS0193 (genetic_marker) Gossypium arboreum

Marker Overview
NameMUSS0193
AliasMUSS193
Genbank IDN/A
TypeSSR
SpeciesGossypium arboreum
GermplasmAKA 8401
Source TypeEST
Repeat MotifTA(10)
PCR ConditionAnnealing temperature: 55
Primer 1MUSS193_F: GAAAATGAGCACTTCTCCGC
Primer 2MUSS193_R: AATGCGAATTGATCCAACAG
Product Length200
ContactUlloa, Mauricio
CommentPrimer data obtained in 2007-11
Germplasm
Stock NameType
AKA 8401cultivar
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
MUSS193_FMUSS193_FGossypium arboreumprimer
MUSS193_RMUSS193_RGossypium arboreumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
2.5 span lengthqSL2.5.GG-RIL.15_ch05-1.xy12.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch05.xy12-bc.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch05.xy12.3Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch05.xy12.4Gossypium hirsutumQTL
fiber strengthqFS.GG-F2_ch05-2.cz08Gossypium hirsutumQTL
fiber uniformityqFU.GG-F2_ch05-2.cz08Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-F2_ch05-2.cz08.1Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-F2_ch05-2.hd08.2Gossypium hirsutumQTL
fiber elongationqFEL.0s-RIL_ch04.ay10Gossypium hirsutumQTL
fiber uniformityqFU.0s-RIL_ch04.qz08.1Gossypium hirsutumQTL
fiber elongationqFEL.GG-RIL.16_ch05.hd15.2Gossypium hirsutumQTL
fiber strengthqFS.GG-RIL.16_ch05.hd15.2Gossypium hirsutumQTL
2.5 span lengthqSL2.5.GG-RIL.16_ch05.wh15.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
MUSS193MUSS193Gossypium arboreummarker_locus
MUSS193aMUSS193aGossypium arboreummarker_locus
MUSS193bMUSS193bGossypium arboreummarker_locus


Contact
NameDetails
Ulloa, Mauricio
Description:Breeding, genetics, and Genomics
First name:Mauricio
Last name:Ulloa
Title:Research Geneticist
Institution:USDA-ARS, W.I.C.S., Res. Unit
Address:17053 N. Shafter Ave., Shafter, California 93263
Country:United States
Email:mauricio.ulloa@usda.gov
Phone:661-746-8009
Fax:746-746-1619
Keywords:Breeding and Genomics
Last update:27-Apr-2010
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D05chromosomeD05:3760786..3760987 +
A05chromosomeA05:4206820..4207023 +
CM018219.1chromosomeCM018219.1:3458030..3458229 +
CM018206.1chromosomeCM018206.1:4169312..4169513 +
Chr11chromosomeChr11:56188059..56188258 -
Chr05_CRI-A2_v1.0.a1chromosomeChr05_CRI-A2_v1.0.a1:4114358..4114557 +
D10_05chromosomeD10_05:57143971..57144172 -
CM016626.1chromosomeCM016626.1:6105464..6105657 +
At_chr9chromosomeAt_chr9:51305085..51305286 +
Dt_chr9chromosomeDt_chr9:65786009..65786210 -
scaffold119872supercontigscaffold119872:93..296 +
D05chromosomeD05:3600603..3600804 +
A05chromosomeA05:3721950..3722153 +
Ghir_D05chromosomeGhir_D05:3734807..3735002 +
Ghir_A05chromosomeGhir_A05:4201880..4202081 +
D05chromosomeD05:3540080..3540281 +
A05chromosomeA05:4076634..4076837 +
D05chromosomeD05:3645635..3645836 +
A05chromosomeA05:4179904..4180105 +
D05chromosomeD05:3506014..3506215 +
A05chromosomeA05:4583903..4584106 +
scaffold1848supercontigscaffold1848:301485..301684 -
scaffold1180supercontigscaffold1180:32284..32485 -
Gbar_D05chromosomeGbar_D05:3629101..3629300 +
Gbar_A05chromosomeGbar_A05:3866471..3866672 +
D05chromosomeD05:3777865..3778064 +
A05chromosomeA05:4325601..4325802 +
CM017627.1chromosomeCM017627.1:3602164..3602365 +
CM017614.1chromosomeCM017614.1:4197414..4197615 +
CM017653.1chromosomeCM017653.1:3803744..3803941 +
CM017640.1chromosomeCM017640.1:4234352..4234553 +
CM017705.1chromosomeCM017705.1:3615341..3615540 +
CM017692.1chromosomeCM017692.1:4134502..4134701 +
Sequence
>MUSS0193 ID=MUSS0193|Name=MUSS0193|organism=Gossypium arboreum|type=genetic_marker|length=200bp
GAAAATGAGCACTTCTCCGCAACTTCTGAACTGAAGTCTGAATCAAAAGC
TTCTCTAGCTGGGGCTGCAATGCAACGTTGCCTTGCTGGGTTTGAGAGAC
TCATGGTGTCTTTAACCCCCAACATCAAAGGAAAAAGAAAAGAAGCTATA
TATATAGATATATATACACATATATATATACTGTTGGATCAATTCGCATT
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocus
1Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008)Jiang-Ling-Zhong-Mian x Zhe-Jiang-Xiao-Shan-Lu-Shu, F2 (2008).JZ-F2_A03N/AA_chr.03103.1MUSS193
2GX1135 x GX100-2, F2 (2013)GG-F2_chr05-2N/AAD_chr.0531.6MUSS193
3GX1135 x GX100-2, RIL (2015)GG-RIL.15_chr05-1N/AAD_chr.05122.9MUSS193
4GX1135 x GX100-2, RIL (2016)GG-RIL.16_chr05N/AAD_chr.05122.9MUSS193
50-153 x sGK9708, RIL (2016)0s-RIL_chr04N/AAD_chr.0445.8MUSS193a
60-153 x sGK9708, RIL (2016)0s-RIL_chr04N/AAD_chr.0448.7MUSS193b
70-153 x sGK9708, RIL (2017)0s-RIL.17_chr05N/AAD_chr.050MUSS193b
Image
File NameLegend
45_FISH_GEN-178-1117_fig2.jpgBAC clones and their corresponding genetic markers of the 22 probes according to FISH signal patterns in Figure 1. [Image from Wang et al., 2008, GEN-178-1117]