JESPR0042, JESPR0042 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	JESPR0042
Alias	JESPR042
Genbank ID	AF352073
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	AF352073.1
Source Type	genomic
Repeat Motif	(CTT)12
Primer 1	JESPR0042_F: CGTTGCCGTCTTCGACTCCTT
Primer 2	JESPR0042_R: GTGGGTGGCTAATATGTAGTAGTCG
Polymorphism	P_ JESPR0042
Publication	[view all]
Comment	Primer data obtained in 2002

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	AF352073

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
A05	chromosome	A05:43017334..43017475 +
Chr05_CRI-A2_v1.0.a1	chromosome	Chr05_CRI-A2_v1.0.a1:43610250..43610372 +
At_chr9	chromosome	At_chr9:82594716..82594849 -
A05	chromosome	A05:39686686..39686827 +
Ghir_D03	chromosome	Ghir_D03:22962081..22962209 +
Ghir_A05	chromosome	Ghir_A05:41970586..41970724 +
A05	chromosome	A05:41409091..41409232 +
A05	chromosome	A05:42918485..42918618 +
A05	chromosome	A05:42012533..42012674 +
At11	chromosome	At11:60451190..60451318 +
scaffold3165	supercontig	scaffold3165:530..658 +
scaffold8169	supercontig	scaffold8169:235078..235188 -
Gbar_D03	chromosome	Gbar_D03:22353258..22353386 +
Gbar_D03	chromosome	Gbar_D03:22177207..22177335 +
CM017614.1	chromosome	CM017614.1:42005576..42005703 +
CM017640.1	chromosome	CM017640.1:43446437..43446555 +
A05	chromosome	A05:43394190..43394331 +
Chr05	chromosome	Chr05:44336434..44336553 +
Chr05	chromosome	Chr05:44668519..44668641 +
B_05	chromosome	B_05:42657764..42657886 -
F05	chromosome	F05:37339782..37339949 +
Chr05	chromosome	Chr05:69914466..69914585 -

Publications


Year	Publication
2001	Reddy O, Pepper A, Abdurakhmonov I, Saha S, Jenkins J, Brooks T, Bolek Y, El-Zik K. New dinucleotide and trinucleotide microsatellite marker resources for cotton genome research. Journal of cotton science. 2001; 5(2):103-113

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
AF352073.1	AF352073.1	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	HS-46 x MARCABUCAG8US-1-88, RIL (2009)	AD_ch05_At.05	N/A	23	JESPR42-140	View
2	JLZM x ZJXSLS, F2 (2008)	A_JZ_A09	N/A	175.4	JESPR42-a	View
3	JLZM x ZJXSLS, F2 (2008)	A_JZ_A11	N/A	28.3	JESPR42-b	View
4	TM-1 x 3-79, RIL (2012)	AD_ch05_At.05	N/A	128.76	JESPR042	View
5	TM-1 x 3-79, RIL (2014)	AD_ch05_At.05	N/A	71.6	JESPR042	View
6	Monsanto SSR Bin Map, (2009)	AD_ch05_At.05	N/A	61	JESPR042	View
7	Xinluzao-1 x Hai-7124, F2 (2008)	AD_chU	N/A	51.8	JESPR42	View
8	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch05_At.05	N/A	175.8	JESPR42	View
9	Pima S7 x Acala 44, F2.V76 (2005)	AD_chU	N/A	0	JESPR42	View
10	TM-1 x 3-79, RIL (2012.v3)	AD_ch05_At.05	N/A	71.63	JESPR042	View
11	PD 94042 x (AD)4-08, F2 (2016)	AD_ch05_At.05	N/A	257.1	JESPR42	View

Sequence

>JESPR0042 ID=JESPR0042; Name=JESPR0042; organism=Gossypium hirsutum; type=genetic_marker; length=142bp
CGTTGCCGTCTTCGACTCCTTGGGCAATGCTCCTTGTGCCCTGACATTGT
TTATTTACCTTTTACTTTCTCCTTTTCTCCTCTTCTTCTTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCGACTACTACATATTAGCCACCCAC

Search form

JESPR0042, JESPR0042 (genetic_marker) Gossypium hirsutum