Gh277, Gh277 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	Gh277
Genbank ID	DQ908217
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	DQ908217
Source Type	genomic
Repeat Motif	AGA(14)
Primer 1	Gh277_F: TACTAAAACCAAGGCAATAAAGTGA
Primer 2	Gh277_R: CACCACCTTCCATATATCTTGCTC
Publication	[view all]
Comment	Primer data obtained in 2008-01 from Hoffman, Steve M.

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	DQ908217

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
D10	chromosome	D10:66299538..66299662 -	Gossypium hirsutum (AD1) 'TM-1' genome UTX-JGI-Interim-release_v1.1	n/a
scaffold1251.1	supercontig	scaffold1251.1:268432..268538 -	Gossypium hirsutum (AD1) 'TM-1' genome CGP-BGI_v1	n/a
scaffold4398_D10	supercontig	scaffold4398_D10:12845..12969 +	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	n/a
Ghir_D10	chromosome	Ghir_D10:66033101..66033222 -	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
D10	chromosome	D10:65250796..65250920 -	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
D10	chromosome	D10:64216555..64216661 -	Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1	n/a
D10	chromosome	D10:62444955..62445076 -	Gossypium hirsutum (AD1) 'ZM24' genome CRI_v1	n/a
scaffold38129	supercontig	scaffold38129:15383..15481 -	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
Gbar_D10	chromosome	Gbar_D10:63571866..63571964 -	Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1	n/a
CM017632.1	chromosome	CM017632.1:62629620..62629720 +	Gossypium tomentosum (AD3) genome HGS_v1.1	n/a
CM017658.1	chromosome	CM017658.1:65771525..65771637 -	Gossypium mustelinum (AD4) genome JGI_v1.1	n/a
D10	chromosome	D10:65625666..65625790 +	Gossypium hirsutum (AD1) 'TM-1' genome UTX_v2.1	n/a
Chr11	chromosome	Chr11:46430843..46431109 -	Gossypium lobatum (D7) genome ISU_v1	n/a
Chr11	chromosome	Chr11:46431245..46431487 -	Gossypium lobatum (D7) genome ISU_v1	n/a

Publications


Year	Publication
2007	Hoffman S, Yu J, Grum D, Xiao J, Kohel R, Pepper A. Identification of 700 New Microsatellite Loci from Cotton (G. hirsutum L.). Journal of cotton science. 2007; 11(4):208-241

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
DQ908217	DQ908217	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Emian-22 x 3-79, BC1 (2011)	AD_ch20_Dt.10	N/A	144.26	Gh277	View
2	TM-1 x 3-79, RIL (2012)	AD_ch20_Dt.10	N/A	8.8	Gh277	View
3	(YM1 x CCRI35) x (YM1 x 7235), 4WC (2012)	AD_ch20_Dt.10	N/A	106.9	Gh277	View
4	Yumian-1 x T586, RIL (2015)	AD_ch20_Dt.10	N/A	167.6	Gh277	View
5	Yumian-1 x 7235, RIL (2015)	AD_ch20_Dt.10	N/A	135.7	Gh277	View
6	TM-1 x (TX-0256 + TX-1046), CSIL (2016)	AD_ch20_Dt.10	N/A	1	Gh277	View
7	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch20_Dt.10	N/A	0	Gh277	View
8	LMY28 x XLZ24, RIL (2018)	AD_ch20_Dt.10	N/A	8.21	Gh277	View
9	TM-1 x 3-79, RIL (2012.v3)	AD_ch20_Dt.10	N/A	7.07	GH277	View
10	MGG-293-793, MAGIC (2018)	AD_ch20_Dt.10	N/A	97.2	Gh277	View
11	TM-1 x Hai-7124, BC1 (2012)	AD_ch20_Dt.10	N/A	6.5	Gh277-100	View

Sequence

>Gh277 ID=Gh277; Name=Gh277; organism=Gossypium hirsutum; type=genetic_marker; length=116bp
TACTAAAACCAAGGCAATAAAGTGAAGAAGAAGAAGAAGAAGAAGAAGAA
GAAGAAGAAGAAGAAGAAGAAGATGAGAACAAGCTAAATAAAGAGCAAGA
TATATGGAAGGTGGTG

Search form

Gh277, Gh277 (genetic_marker) Gossypium hirsutum