Gh039, Gh039 (genetic_marker) Gossypium hirsutum

Marker Overview


Name	Gh039
Alias	Gh39
Genbank ID	DQ907983
Type	SSR
Species	Gossypium hirsutum
Germplasm	Tamcot Sphinx
Source Sequence	DQ907983
Source Type	genomic
Repeat Motif	AAG(15)
Primer 1	Gh039_F: CCAGTTTATAATAAGAATCATAGTTTGGTGG
Primer 2	Gh039_R: CACATTCACTTCAAAGTCCATCAC
Publication	[view all]
Comment	Primer data obtained in 2008-01 from Hoffman, Steve M.

Cross References

External references for this genetic_marker


Database	Accession
DB:genbank	DQ907983

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
A06	chromosome	A06:2925543..2925663 +	Gossypium hirsutum (AD1) 'TM-1' genome UTX-JGI-Interim-release_v1.1	n/a
scaffold445.1	supercontig	scaffold445.1:615015..615135 +	Gossypium hirsutum (AD1) 'TM-1' genome CGP-BGI_v1	n/a
A06	chromosome	A06:2445164..2445284 +	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	n/a
Ghir_A06	chromosome	Ghir_A06:2820380..2820497 +	Gossypium hirsutum (AD1) 'TM-1' genome HAU_v1 / v1.1	n/a
A06	chromosome	A06:2661945..2662065 +	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
A05	chromosome	A05:14311514..14311895 -	Gossypium hirsutum (AD1) 'TM-1' genome ZJU-improved_v2.1_a1	n/a
A06	chromosome	A06:2735748..2735868 +	Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1	n/a
A06	chromosome	A06:2695494..2695614 +	Gossypium hirsutum (AD1) 'ZM24' genome CRI_v1	n/a
At06	chromosome	At06:2450752..2450860 +	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
scaffold3896	supercontig	scaffold3896:548791..548899 +	Gossypium barbadense (AD2) '3-79' genome HAU_v1	n/a
Gbar_A06	chromosome	Gbar_A06:2622631..2622739 +	Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1	n/a
CM017615.1	chromosome	CM017615.1:2648626..2648761 +	Gossypium tomentosum (AD3) genome HGS_v1.1	n/a
CM017641.1	chromosome	CM017641.1:2855344..2855464 +	Gossypium mustelinum (AD4) genome JGI_v1.1	n/a
A06	chromosome	A06:2802284..2802404 +	Gossypium hirsutum (AD1) 'TM-1' genome UTX_v2.1	n/a

Publications


Year	Publication
2007	Hoffman S, Yu J, Grum D, Xiao J, Kohel R, Pepper A. Identification of 700 New Microsatellite Loci from Cotton (G. hirsutum L.). Journal of cotton science. 2007; 11(4):208-241

Germplasm


Stock Name	Type
Tamcot Sphinx	accession

Relationships

The following sequence_feature feature(s) derives from this genetic_marker:


Feature Name	Unique Name	Species	Type
DQ907983	DQ907983	Gossypium hirsutum	sequence_feature

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Emian-22 x 3-79, BC1 (2011)	AD_ch06_At.06	N/A	27.58	Gh039	View
2	TM-1 x 3-79, RIL (2012)	AD_ch06_At.06	N/A	100.25	Gh039	View
3	TM-1 x 3-79, RIL (2014)	AD_ch06_At.06	N/A	100.2	Gh039	View
4	TM-1 x 3-79, RIL (2011)	AD_ch06_At.06	N/A	15.3	Gh039_131/119	View
5	CCRI 12-4 x (AD)5-7, F2 (2015)	AD_ch06_At.06	N/A	130.4	GH39	View
6	TM-1 x 3-79, RIL (2012.v3)	AD_ch06_At.06	N/A	100.25	GH039	View
7	TM-1 x Hai-7124, BC1 (2012)	AD_ch06_At.06	N/A	107.2	Gh39-120	View

Sequence

>Gh039 ID=Gh039; Name=Gh039; organism=Gossypium hirsutum; type=genetic_marker; length=121bp
CCAGTTTATAATAAGAATCATAGTTTGGTGGTTGAGGAAAAAGAAGAAGG
AAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGGTG
ATGGACTTTGAAGTGAATGTG

Search form

Gh039, Gh039 (genetic_marker) Gossypium hirsutum