Glon_08G014340

Gene Overview
NameGlon_08G014340
Unique NameGlon_08G014340_F1_HAU_v1
Typegene
OrganismGossypium longicalyx (Gossypium longicalyx)
Alignments
The following features are aligned
Feature Name Type LocationAnalysisReference
Chr08chromosomeChr08:21756141..21757203 +Gossypium longicalyx (F1) genome HAU_v1n/a
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Gossypium longicalyx (F1) genome HAU_v12023-09-08
Relationships

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
Glon_08G014340.1Glon_08G014340.1_F1_HAU_v1Gossypium longicalyxmRNA


Sequences
The following sequences are available for this feature:

gene from alignment at Chr08:21756141..21757203+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>Glon_08G014340_F1_HAU_v1 ID=Glon_08G014340_F1_HAU_v1; Name=Glon_08G014340; organism=Gossypium longicalyx; type=gene; length=1063bp; location=Sequence derived from: Chr08:21756141..21757203+ (Gossypium longicalyx
CGTTCTTCTATCTCTATCTCTTGTGTTTGTGGGGGCAGTCCAACCTCTTC CACCTTCCCACCACTTTCTCAATCATTCTCAGTGGAGCCCTCAGAATTAT AGCCATTCCCATCAGATCATATGGATGGCCAAGAACTTATTAGTACCCCA CCGCCTGCAGCGCCGCCACCACTCACCGCTCCTTTCCTCTTTGCACCTTC CACAACTCCATCTTCCTCACTGCACCCTCTTCCTCCTTTAGAATCTCAAA TCATCCCTGATATTGATTGGGTTAGCCTCCTCTATGGTCAAGCCTTGCTG CTGCAGGGTCATGATGAGAGCAAGCCAGTGACTGAAACAGCTTCTTCTTT GATGGCCGAAAGTGGAGGTTGCCATCAGATTGAGAATGGCAACCAAGACA AGAGGAAAGGTAACCGGTTCAAGAAGACAACCCGACCGAGGTTTGCGTTC CAAACCAGGAGTGCTGATGATATTCTGGACGACGGCTATAGGTGGAGAAA GTACGGCCAAAAAGCTGTGAAAAATAGTAATTATCCAAGGTTCGTTCGTT TATCATCAAAATGGCTCTTGTTTTCTCTTTTATATATACGTTGTTTGTAG GTTCGTAACGCGTCATGCATACACAAGCAAAATTTGCATGGAACATATAT AAACAATTTCTTCAAGCATACTTAATTGGTAATTTCGATCCATAAACCTA ATTAGCTTTAGGGTTCGTCTGTTAGACAATTGACACACACATATACAATA CAATATGTTTTATAACTTTGTTGTTATAATTGAAATAGGAGTTATTACCG GTGCACACATCACACATGCAATGTGAAGAAACAGGTTCAAAGGCTGTCGA AAGACAGCAGCATCGTGGTGACGACATACGAAGGGATCCACAATCATCCT TGTGAAAAGCTAATGGAAACCCTAACTCCTCTTCTCAAGCAAATGCAATT CCTCTCTAGGTTTTAATATCCAATTTCTTTCATTTCTCCTAATCACTTAA TATCCCCAACCCCAACAACAAATAATTTCATACTTACCTAATTTCCCTTT CTTTATTTTTCCA
back to top