micronaire

QTL Overview


QTL Label	qMIC.TSP-CIR0105
Published Symbol	Micronaire
Trait Name	micronaire
Trait Alias	N/A
Trait Study	TSP-Zeng-2009
Population	N/A
Female Parent	N/A
Male Parent	N/A
Colocalizing Marker	CIR0105
Neighboring Marker	N/A
Environment	US_MS_STV_2006
LOD	N/A
Additivity Dominance Ratio	N/A
R2	N/A
Comments	N/A

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
A01	chromosome	A01:1986441..1986539 .	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	CottonGen QTL alignment to genome using associated markers
scaffold285827	supercontig	scaffold285827:95..193 .	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	CottonGen QTL alignment to genome using associated markers
scaffold3708_D01	supercontig	scaffold3708_D01:68638..68736 .	Gossypium hirsutum (AD1) 'TM-1' genome NAU-NBI_v1.1	CottonGen QTL alignment to genome using associated markers

Publications


Year	Publication
2009	Zeng L, Meredith WRJ, Gutiérrez OA, Boykin DL. Identification of associations between SSR markers and fiber traits in an exotic germplasm derived from multiple crosses among Gossypium tetraploid species. Theoretical and applied genetics. 2009; 119(1):93-103

Sequences

The following sequences are available for this feature:

QTL from alignment at A01:1986441..1986539
QTL from alignment at scaffold285827:95..193
QTL from alignment at scaffold3708_D01:68638..68736

QTL from alignment at A01:1986441..1986539

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qMIC.TSP-CIR0105 ID=qMIC.TSP-CIR0105; Name=micronaire; organism=Gossypium spp.; type=QTL; length=99bp; location=Sequence derived from: A01:1986441..1986539 (Gossypium hirsutum
GTCTCTTGTCTTTCTTTCTTACACTGAACCAGAAAAACACACACACACAC
ACACACACACACTGTTTTGTCTGCTGTTTTTTCTGGGTTCAGTTTGGTT

QTL from alignment at scaffold285827:95..193

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qMIC.TSP-CIR0105 ID=qMIC.TSP-CIR0105; Name=micronaire; organism=Gossypium spp.; type=QTL; length=99bp; location=Sequence derived from: scaffold285827:95..193 (Gossypium hirsutum
GTCTCTTGTCTTTCTTTCTTACACTGAACCAGAAAAACACACACACACAC
ACACACACACACTGTTTTGTCTGCTGTTTTTTCTGGGTTCAGTTTGGTT

QTL from alignment at scaffold3708_D01:68638..68736

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qMIC.TSP-CIR0105 ID=qMIC.TSP-CIR0105; Name=micronaire; organism=Gossypium spp.; type=QTL; length=99bp; location=Sequence derived from: scaffold3708_D01:68638..68736 (Gossypium hirsutum
GTCTCTTGTCTTTCTTTCTTACACTGAACCAGAAAAACACACACACACAC
ACACACACACACTGTTTTGTCTGCTGTTTTTTCTGGGTTCAGTTTGGTT

Search form