GF110988

Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Sequences
The following sequences are available for this feature:

region sequence

>GF110988.1 ID=GF110988.1|Name=GF110988|organism=Gossypium hirsutum|type=region|length=360bp
ctacttccggaagcgaacttactgtttataataatcgatatttgagcatt
tagagaatgtgaaaaatatacagaggatcggtttcaatggttgtgaggac
aagcaattttgaagctggatggagttcttggatgtggtgggccgataaga
attcggaacgtctaaaaacgcctatagtttccgaatcccaaaaaaaccag
atgacgatccccatgattatcctattctgttggccgtgctagtctctttg
tgaaacatgttgaacacccctacaatttcttccgatatgttaaccgatac
tactaaaaatattaaggaagaccttctctctgttcgtgtcactcacaata
tccaccccta
back to top