AC245651

Overview
NCBI AccessionAC245651
VersionAC245651.1
Typeregion
SpeciesGossypium hirsutum
LibraryCotton BAC Library
Analyses
This region is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Cotton Data2021-06-16
Libraries
Library NameType
Cotton BAC Librarygenomic
Sequences
The following sequences are available for this feature:

region sequence

>AC245651.1 ID=AC245651.1|Name=AC245651|organism=Gossypium hirsutum|type=region|length=117514bp
ctgactataccaataactctattcttttggtcgttccccaatcattcatc
acaagtaatttttgaagcacttgtttaaggcttccgtttgtccgtctggt
tacggatgttaagcacttgaatggtgaagttttgtcccaagcttagtgaa
aagtttctgccaaaaattgctgacaaagaccttatccctgtaggaaacta
tggtgtccggaagaccatggagtttgaaaatattatctaagtaagcttga
gcaactgttagagccgagtatagatgggttaaagccacgaagtgcccata
tttcgttaaacggtctactacaacccatataatgtcattcccctataaaa
ctggcaacccatttataaagtccatgcttatatctgcccacactctagaa
ggtatcgatagtggctgcaagagtctcggtgaagctgatggattatattt
gttcctttggcaaacaccaaattctctcacccacctttttatgtctttgg
acatccatttctaatagacccaatttgttatacgatattgtgtggtttta
gtgcttgagtggccccctaaggcattgttatgaaagaaagtaaaaagttt
cttttgtatttcttagttaagatcctaccaccaacttccctttttctcct
gagacacaaactatcctatgtgtattttggatgggagctaggattttgtt
gcaattcgacacacaaattacttaatcgtgggtcgtgttttcatgaattc
tgcacacgaggccataactctgagacaacgtaacttcccactatttgaaa
cagttgctttgaggagtagtcgggttctcgagaaaaaacgtcagctacta
tattcttactccatttcctgtacacaatatcaaaactatatcctagcatt
ttggccacccatctttgttggaagggtgcgatggcctgttggtcgaaaat
gaaacggaggctttgatggtcggttcggatcttaaaatgtcaaccaacca
aatattggtgccattttttaacagataatcgtgctgttagcatttctttt
ttgtaaatagataacgttttataccttaccctaaggccttgcttaaaaat
gccattgggtaacctcgttgatggaggatggccctaactccaatatcgct
agtgtcaatgtcaacacaaaatccattttcaaaatcaggtagcattagaa
ttggggctgaactgatggccactttcaaagcttggaaagcttcatcgacg
aacgttgtccatgcccattgtttttttattcaaaagcttggtaaaaggtt
tagcaatggtttcgtacccttgtataaacctcctataataccccgataat
cccaataatgatctaagctccttagttgattgtggtttaggccagatgaa
cacattatcgacctttgattgatctatgaccacagtgccactagagatga
catagcctaagtactcgatactagtagcccaaactgatatttttcttttt
tagtcaaacaactagtgggaccgtaagatgttaacacctgttctaactgt
aataactgttcaaaccatgagttagagtataccaatatgtcattaaagaa
aacaagtaccgatttcctcaacaaagggttttaaaaattgaatccattag
agcctagaaggtaaatgaagcgtcagtgagcccgaaaggtatcactaaaa
ctcataataactttcatgagttcggaatgtcgtcttgtagatattctttt
tttatgcatgcatgcgaatttgataatagctggcgcaaagatccagtttt
agaaaaaaaaacattacctaaccaagctcatctaatagtttttctattac
aggaattgggaaattgtctctgatagttaacttatttaattatcgatagt
ccacacaaagatgccaacttctgtttcttttttcttgaccattacaattg
aagaagcaaatgcactattactgtctctaataatcctatcgtggaacatc
tcctagatcaatcgttccatctcattttttgaatagtcaggtagttgtaa
caccccgaattttggggttagaagatttgggttatgtggttagggtcagt
gagaaggttacgctattgtgtttagttgtgcatttaagtgtcagaatgag
catgttggtctgctggttgtgtgagtgttagaataccccaatgttctggg
ttcgattcattgtgtgtactatttggaggatacttttatttttattatct
tgttttgttttgttttgttttaattttaagtatataattatttatttttt
attttatatgggattcttttctttctcctggaacaccctcctcttctttt
ctttctgtctcttttttttattttttttgtttcttctttatttttatttt
tattttcaaaaaatagattttactggttgatttcgggaatttcactcatc
tgtcgtcgagttagtgtcgaattatctccaattgtaaaacaggtgtggga
ttcataactctttttgttattgtgaattggagatacgattgtagatttct
gtttcatgcgtgttgggaacctttcccttcatttttcatatttttcggca
tgctttgcgaatttttgacattgtttttgtgtgttgggaattggaccttt
aaaaaggtagattaatgtgttgatagctagaatttgggtgtaatattgat
atactttttgggttgtcaaggtctggggttcgttttaaggttgtaaaatt
gagttttcaaccaannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnntatatttttcctacgactccatgtgattctgcttag
aaactggtatgttaatggatgttgaatgtcaagtttggagtagtggaatt
aggagataagaccaaaacgcgtgccctctgggagactatacaaatcaaaa
gtaattaatcttttttatcagtaccttaataaatagcccttctgtattca
ttttattgtgaaaagaaacatggttttgagggtaagaacgagtcaaaagg
ttaacttcccgacagaaaataaaggaaaagttaagatcccactcacctat
atcaaacactttttctcaagatatttgctacgagacagtacctagttttg
gtccaagcaattgaaacatcatcatcagtgaaatgggttctctaatggca
ggatgggattctcctgtatcggcttctaaatcaggttgtcagcttaatgt
tttccgtggtgtttttatttatgcttagtctaatttctggctatttgaaa
ttcttccagcaacaatccaaaggaatcgatcacttaccaaggaagagatt
gaagcttactggaaatcaaagaagaaaactgaggaagatcatcttaaggc
tatttatagtccatcagatagctccaaccagctggtgccaatttcttttc
ttttttttttaattaaagatttagacatgaataaagtttttaatcaagta
gttcacatttaaaacaggaaattccatctcagggctatggaaggagcatt
atgagatcaagctccatgccttcacctcatacagaacagggtttccttca
catggacgccgaaacaagcctggaggatatcgtaaagaaaaatgggtggt
aagtagctataaatcttagtcgactcatcaagacaaaaaaatggtgacaa
ttttttgttaacgtgggtgactgtatgtaggtggacacgaagcaattggg
cattcttgaatgaaccttccgttcttgatggccctactaatagttacaca
tcgcagttccacattgccaaccttgctgcttccaagcttaacaaagatag
aggaatcagtgcttaatctttacctcctaaacctatctttttttcagcgt
atttgtctacctaatccgcatgtagttatgttctacaaagttgtaacagc
atttatgtgttgggtgtgtcacctggtcaggagtcatatgtgatccaggc
tttcaattctttaatgtatgtatacatcccacacatattcaggcatatgt
atgaaaataaaatctttcaaaaaaaaaataaaaataatagaacataacta
ttccatanattatagattctcatatttgacgctcaactttgataacataa
ttgtactctttggctccaattccatttcttgtgtaatcaaccggcaaaat
tgtaagttaatcttccctcccctctgctctaatgcaagttccaacttagg
ggcttagctttcctgtcaaaaatttgcgtaaccaaatacttgctgaaatg
ggcgtcgaaaaaaccattccataaccttccccttaaataaaaactaagcg
tgaggtgacaaacattgatctacccaatttattccctccacaaatcccgt
ttcattctattgggttcacgatggcatcgctccatatgccttccttcccg
tcgggtccccggccccctctttcatcttcttccctgcttccctcctccct
agacaacaaatccgaacccaacctctccactcctagacctcgccacctct
cgctcggcccatcgccctcgtcatctatcctccctccacggggccctcca
ctcccacaccactcctcgtcccagtgtgctccgaccaccacccccgactt
cctttcttccactccagttcccaatgtccctacctttcgtacctcctggc
tctctagaagcctcccctccagtctagcagcatcgctctgtaactgccct
tactcgactatattctctcctctcaccgtttctcgatgcatcgagcatcc
cattactaatcacaacttcaccccctccacaacccgccctcaatccccct
ctacattaccccaccattctatcgatctctcccatctcactctatcgacc
ctctaagactccctgctccaccccatatacgtagccgcgccggcctctgc
actcagcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnttgattatgtgagtacttataggttttatattttgatctaag
tgttaattaaacatagctctggtgaatatataaaaatttggtgggggtgc
ttggatgtggctaaggaaataataaatgctgaatttaatatcttcaggtt
ccggtggggctggagagctatgccgtgaagcatttaaataaaggaaaagt
gtatatctcaaagagcagcccgcaaagcatggtgaatgcttattcatcgc
agttccaggctgatttttcacagttcataaagtcacgttcccaggagttg
gtcccaggtggccgcatggtcctttctttcctgggcaggaaatccattga
tcccacaaccgaagatgggtgctatcagtgggagttgttatctgaagcat
tgatgagcctggtcaaagaggtacaaacattacttcaagcattgattaag
tgattggcgaaagtgggaattgaggttaatttcaactttttttaacacat
attgttgcagggtttaattgaagaggacaaagtagcgtcattcaatgcac
cgtactatgctccgtgtgcggaggaactaaaggtggagattctaaaggaa
ggatcattcataattgatcggctggaagcttttgaagtggactgggatgg
aggcgcggttgctgacacccataatgaacaagggaaaatgatggtgggag
agcgagtggctaaaaccatcagagcggtggtagaatcgatgttggaatcc
acttccgactgggacaagatacgatggatgttttattcagcaagttcgca
gagattgtgggaaaccacttgtcaaagactagaaccaagtacatccattt
cgtgatttcactggttagaaaggctagtcatatcaacttggaagctcagc
ctatggatgtttttcttttttgaagtaaaatcagtggatatgattggtcc
aaaacctggcttcccattgggccaaatctttgccagttacgtctacatta
tttttattataaaaaaattaagtgagtgaaaatattaattttaagtttat
ttaattttttcaatgtgttatcaagcttttagtaatagattaattacgta
gcatatcaattcattgaattaattaataattaatttcttccttgaactat
aaccaaaaaaaaaaattcacacttttagactttttttaacagaaaatcta
aaaacatcaataaaaatcttaaatttcataatttattttatgaaattgta
aaaacatttttaaaattactattataagaaaattctttaaattttaaaat
atacctaaaatctaaaacaatttaaatgctttaaaatttgcctaaaattt
taaaaaaactaaaaaaagaattatttttttcttctattaactactgcata
attgtaattttaacaagtttttttataatttcaaaattataaattatgaa
ttttcagattttttattgttttaccgtcaaaaaatctaaaagtaccaaac
cgatactttagttataattcagacaccaaattagctattaagcctatgag
aaaatgtattatgtcatcaatttgttagtgattattataacttttttata
gttgggtgatgataaaaacttactaattattgagtgatttttaccaataa
acaaaaaaaaaaaaaactttatttacttgatgaatggtgacttaaccgcc
ccgttgatatctgctgtccttttaacagtgaaaggaattaaattatccat
tccgattaatttaaatattaaattggtatttnccataataaaccgaaaaa
atttaaacttttaattatttaaatgactagtgataaatttttcccttaat
tctttaaattaacctcccccacgttcagggaaatttaaaagtgattattt
ggaaccctccctttaaaaacccaagttgtcaccttttcacacccatatcc
cctttaaattaaccaaacaccccccctaaaaatgtttctccggccacttc
ctctttggctccacacggaccntttttcacactttcctaacccgtccccc
tctgatncatttttcttaacacattaacccgggncggcttnnnggctgca
tccttatcgtcggtcgtcatctcnggctcgggnccccccccccctncggg
tntctcnnaactccntccncccccctacttctccnnnncccggtntnccc
tctcctactnnccncccccntctcccccancctcctcccctcnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntcgagccg
gtacctagtatcacatggccctagcacacttctcgtgtctgttggccgtg
tgtataagtcactatatatatattgttatggcacgactggattacatagg
cgtgtcaggtgcccttgtaaggcacacggcctagtcacacgggcgtgtga
cctcaacagaattggaaaatttttctaagttctagaaattctgaatgtgt
tcggtttagtcttgaccttttctaaaagtatatcttaagtcttggagact
tctataagagataaattgttgaattgcttatgcattaatgttatgtgata
tccgtgattttgttttgatttgtgatgttctgtctgtctggtaatgcccc
ttacctattctggcgacagttacgagataagggtgttacatttcagtcta
cttaaaaaagctaagagaaagggtttgataaaaagggcaagggttggtag
aagtagatatgggctaacatatttgttttttgctgatgatagtattcttt
ttggagatgttacaattgatggggcaagtaaaatgaaagctatagtagaa
gaatatgaaagggtctcgggtcaattggtaaattttgacaagtcacttat
ctactttagtgttaatgtgtgtctgatgagaacagaaggaacaaatagga
ggaattttgggggtccgcatttctaataacccataaaagtaaattgggct
tccaacaatagtgggcagaaaaaagaaagatgtattcacaaatcaaaaaa
agtgattcatcaaaagaatagagaactggagtatgaggtaattgttaatg
gagggaaattcataaaaatcaattttacaagtaattcctattttttgcaa
tgcaatgtttcttattaccaagttctttatgtcgtgagttaaatagcatg
attgcgaaattttggtggtgtaatgcacatacaaagaaaggtatacattg
gtgtcaatggagaaaggtttattgaccaaaagagaaaggggattaggatt
taaagacttgtccaaatttaatatagctttgcttgtgaaataaggatgaa
gactattgtcaaaaccagtttgtttacttggcacagcatatagacatcta
gaaggctgttggaacaaggttgtggctggtgagtggatgatggtgcaagc
attaatatatggaacgacaactggttaattgagcctgaacaaagaaagaa
tccaaggacatggcattaatacaatatatacaaaggtcgttgatatacaa
agaattcgaaaactttttttatgaagatacgacacggaagaatattaacc
atacctctttcaaacagtactcaaaagaaccacctggtatggaggggcag
taattttggtatctataaggttaagagaagatacatatggattgaagtag
cagatacaaccgccaatgataatccgaatgaggtataaaaattattattc
aagaaaatatagagcctaagactagccagcaaaataaaaaatacatgctg
gaaaattattaaaaatcacatgcccatattatcaaatttacaacaaagaa
acattatagtacaaaatttatgcccagtatgtagaaaaacgaagaatccg
tggagcacatttttcgaaagtgtcttttttctgaacaaatctgcatagta
tgggagtatcattcttgatcgataatgaaaattagaattcggaaacttgg
ttagctacagaactgtcaacaagagatatgctatatataagaaaaataac
agttacattctgggcactatgatacaaccgcaatatggtctatcataatg
gaatgggacaaaatgttttcggagtcgtttctttcataaatgcttacatt
tcagaggttgacagcatattttatcaaaagacatgcaagaaaaataggag
tcaatttggcaactgacagaagatgattgtgtgaaagtaaattttgatgc
atgttttaactatcgtacaaatagctctgtttcaggaattattatcagaa
atagcgaaggattataatggtagtaggcacttaccaaattcgcatgtgag
agatgtgacaattgcaaaagtacaatgaaaaataaataagttcttctttt
attatcaaattatcatctctgtcnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnngcatataataaaactaaaaatggactt
agtgggtctccttgtcatagccctcttgatggcttgaaagtttcaccttg
ttcaccatttaagataatcaaataagtcaccgtagtcatacatgtcatta
ttaagtcaatccattcactacaaaacccattttaatcattactttttgta
aaaagcacactacaccctatcataggctttactaatatcaagtttaagag
aaaaagagccttggtgtctatatttcctcctcttaaatgagtgtaaaacc
tcataagcaacaagaatattatctgttatttgtcttccaggtacaaatgt
gccttgagcttcatcaatacacttgtttaaaactattctaaacctgttaa
caataacctttgatatgattttataaagcacattgcaaaggcttattggt
cgaaattgagtcatacttgtaggagaattagtttttcgaattagcactat
atttttatagttaatcttttccaatcattgtctactattaagaacttgaa
tgcaatatgtcataatctactttcccacgatactctagtatttttgataa
aacaaggttgggaatccatcatcttcggaagctttcattggcgacatact
tttaatagctttctcaatctcttcttcaataaaatcctttgtcagctcta
cactatcagcttcattaatgcacggttgaattcccattagagtccgagta
taatctcatgtagaggaagttgtaaactagaccattgcgacatttgccat
agttttctcatctttaacccattccccactatcgttcttcagctttagaa
ttgtgtttcttttctttctagtccacgcaatactataaaagtatgacgta
tttctatctccaaaccatatccaattagctcgtgcacattgttcccaaaa
taactcatcattgtctacttctaaatttagtgcaatcttaacctttgtta
attctaccaaattttcttcatctagattcttcgcatttagctctaatagt
cttgtgttctagtaatctatttgacgctgcctccctagttgattcgctta
agcccaaagattgaatttatttccttttgctttaagtttagtaggaactt
ccctttggtcttcttccaccacttccaaatttcgctttctaaaccttctt
caattacccaatttgcattaaatctgaattttggttgtcactgtcccttc
tactttgaactcctatctaggacattaacaagtaatgagcaatgatctga
tatagaatacataaggtgtcttacccaaaaatttggaaacattgaccacc
attctgggttcaccactcctatatcaagcctttcacatatattattattc
ggcaaccttcctctcttccatgtaaatcactgacttgaaaatcctaagtc
tgtaagattacaatcagctaaagcttgacgaaatgccaccatttgatttt
cttctcgttgatgccctcccttcttttcaaaagaaaaaaataaaattcat
taaagtctcctaccacaagctatggtagattgttgacgttatttaactgt
cttagcagattccaagaatccctcctacaggtttttccagtgatccataa
aatcccataaatctctaaacccttttacttcattctcgtctgtgatgtca
acaatcaatgtgtgacgctgagaagcttcgtaattgaatgttatactctt
gcttccatctcaacgaaagtcctcctttagaacccatggcattaacatca
atgccattatgtaaaccacatttttttcgaattcattccgtcttttttgc
gcatactttggtttccatgagaaactaaacttagggttgaatatatctca
ctttgttttttagactccttattgcccatgggtgccccaatccccaaaca
ttcctgtaacaccccctacccgtatccattgtcggaataggtacgaggca
ttaccggagtttactgaacatttttagataattctgagtcatttattatt
catattttgaagataatcataacatctctctattgggccctcgaagcccc
aaacatacattaaaaaccaaccgaaattaaatcgggatcataaaaaattt
cgtaaaatcttaaattttattttcatctaagtacttaccatttcaatgct
tcttataattaaacatgttaccattcaatcaatagcttgacacttgtcta
agcgtcaaacaacatcattgttagtatacttgcacatatttcatataaat
tcaatattgatatacttaatttctcgacatgtcacacttgagtttaataa
ttgtctttacttacataatttccttgtatcaacatatcaaagataaccat
atatgtacatgtcatgaaacatatcattctcttaccgtttcttcataagt
atatatcaatcatttcattatatcaatatttcatgctccatcatttccat
atattttatgtatattcattccggtaaagtttatatcaaacttaacataa
attatattccatgtacttattcttatttcgtttatctatcttcataatta
tttcatacaactattttgtacatatatttccatatgaccggttcttgtaa
acatttcacacnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnccagctgcatgctgaggtcatctagaggatcccccacat
gagactgtgatatcagcatttgagtcaatatgctcctgcgagagatatat
atctgatgtttagccagatgatttttcaaggaacaatcttccttcatgag
gaagtagaaaagaagagtcttcgaatgatatttttccactcttagtaatc
tagccacgtgcctgaacaaaatccatatagtctgctcggtaaagatgatc
tccggacaatatcaatacatgctccacatccttggctttggcatcctggt
ggtagtgaaacaaatcatttttggtcaactttcatgatgaaggcggatga
tttcagctcaagtacaaaatctattaactaacctcaaaaacccacacaaa
ttgcctcacagcatcagcagttccttggaaccacttcttcccagcttctc
ctggtgtttgagtggccgccagaacctatgcaaagcaaacgtagcttcat
caaaactttcagaaaagataattacatttcatgagaatggaaattgtaaa
acatcatgatccacgcattaacatggatttctaaataatatgcatagtaa
ggctaaatcagtatggccttacctcaacaaaaccatctccaaaatttaca
ccattcccaaagttgtaagtacgagctaagtgacgattgagggagaagga
gttaaactgagttaagataaatatcttctttatcccactgttgatacagt
tgctcattggaatatcaatcagcctgtaacaccctccaattggaacctgc
aaaccaaataatatcatggaaaaagttcaaatcctaccaatctgagactt
gaaatttaataattgggtttcaccttcaaaatgaaaaatgtttactttca
aaacataaaattagtttttctactctcttaggaaaacggtttcttacggc
tggcttggctctttggctagtaagagggaagaggcgcgtcccagcaccgc
cgccgagtatgatggaagccacattctttgggtctgcttgtggagcctca
aactttggtgtctcaaatttctgacaatcaaaagtttcaaaagcccactt
taaaaagatctgaacagctattactagaagaaatcttgtactagttgttt
aatccttggatgaaacataacattagaaatactttttcttattttcctac
ttaccatagtctccttgttaatttttggggtgataacagagtaagcaacg
cccggtttagcttttttgacaccattttcacctctccaactcttccataa
ctgtgttccaaaattccgacctcctctgatagtctcaccccagaaaacag
tgcctccaataataagaccttggctgatattaaccggactggcggttgca
gtagcctttagcgatatgcagatggattccattgctgaatttattaacca
atagaccaaaatatcaggaaaaactaaagaaaagcaataaattaaaaaat
attaaaagaccatacctcggctaaaaaatactcttagtctacaatgaaat
aaaatcatacaaaaagcaaattactttgttagtggtccaaagatttcatg
gccacaatatgcaactagtattaagaacaatgatcaaagacagattaaaa
ggctgcgacggctttaaactctgcctaagtcaaaaaaaaaaaactggaaa
ctgacagagatccaagaaaaactggaacaacccatatgcaaaatatacct
tttaaaaagaagttgattttagtgcttggatcactcaaatctgtggggaa
ctgagaaatgagcaactaagaagtgtgataaaagtttaaaaaaaagaaat
ctttgatggttggaatgcaagggggaagagcttaatcagcagtgatatct
aagttcaaatagtaaaggagtaaattgtgatccatccgtcacgagaagcc
tcaaaattgggtctttgtcttctcttttctaatacagcatttaattaaaa
gtataattacgtttagttacgtaatgcgctttgatttttccagagtcgct
agctgcgcaaacttccaggacacttggcagaaatatgatttccttttcat
ttgtaacctttctgtatttctttttactagacaatcatcgcatgagacta
gggtggagggttggactattttaccttccatctcaatattttactccaaa
aatgtaagaataatttaatttttgntaattcgtagttaagggcaattaat
tacaatggtcaattatattttttttttttgtataatcataaatttagctt
gtaaagcttacaaattattgtcaatttgatattgatttaacaaatttata
caaaatctaactctaaaacctaaattaaatattaaaaagtgagcattatt
atcttcaaatactaaaatatatcaaaaaaataatatagataccacattag
aaaaaaatgatataatatttattattttttaaataattaaatgtaaaatg
tatcaacagatatagtataaatagataaatatttatctatattttaataa
aaaagagtaaatatcattttatctaaaatcactttcaactgaaattgatt
ttttaaagaaactcaaattgttttgctgtaaatcggctgggctcaaaatc
aaaggaatgaatcggtgctccttttgcaaccctttccattcatctatatt
taaattcattcactgtatttaataacctactcataatttacctcatttat
tttcgattgggttaactgaccttttttttgtcattttggagaaatatata
ttaattatgcttaaaattttaaatagataaattcaaaggtaaaattagag
attgtaaaatttaaatggagcaaatatttttgtttgaataatagatgtaa
ggtgaggtaatttgttcttctgcatgttggtacgcggctcgatgttatcg
tacccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnttttgatatattatttagattaatataatttattaaaataattta
aaaatagatgaaataaatttcaatagcttgtaaatttctcacaccattat
tcatgataatttttcatatattaaactattaaattaccttctatcgtcaa
cgttataaacattttagagagcctgtatgagggaaaataaaaagaaggtt
gagagaaaaatgttaaatgttaaaagaaaaaaattatagattttagaatt
ttagttatagaaaaaattatttcatataattatttatttaaaataaatat
ttaaaaaaattgtgggtcgatctttccaaaaaaaataaaaattgatgggt
tgaatgtggtcagatgtgtagaggcaggaaccttacctcctcaatctgtt
gtagacgctactgaaagggtaaaacaaccgggatcctgtaactattcttc
cacctcttcgctcacctgctgcgggcctccatccccacctttggctgctg
ttgctgcctgcgtgccttttccgctttcttggctaacatgcggcgttttt
tctcgttagcatctatccaggtatagttcgttggtatgtggaaaggatca
accccgtcatgaccatcactatctcttgactggccaccacgactccctct
catccatgaagtccatgatgttgaaccctctgattcttttgacttggcat
cttggaaatgaaccgggctggaaggaggtgttgaaaactcctctatcggc
tgaagctcctcaaatctagtgaaagtcacaaggactcgaatagttgacac
aatagggatggcaacctagaataaggaacatgagacatcaatgtgaatat
gttccaaacttaaatacataacttttgtaaaataattacagtaaccacaa
accaacccaataaaaattgttgagaagcaagtttggaatgttttatgata
ttacacactactccgtactcgtaagtcatcaccactttctatcatgctta
cacaggagtttccacagacaaacatttaaaatgaagatcttttagcacaa
tggccattctcaaagttaacattaacgctttaagaaggaaagacaataga
actggcaagaagaaaaagggaagtattttgctgccacactaataatgcac
attgcatctggttcattcacaacaaggtggcctcctgaaccagaaataca
gatgtacgtagaaatgtaaataactatcaaaaccatgctttgtgatgtca
gaatcatatattcgtattttaatgaagagttatgggcagattccagcaat
atggcaaacctaatatcaacttttaaggatatgtatggatgggtaaaaaa
tggaatggaaagaaaaataagaagaaagaatataggaaagatgattattc
tatatcttaatgcataaaaattgatttttctaaattgaagtgataagaga
aaagagaaaaatatatatgttaatttaaaattatatattttttaaaatat
tttttttcaactctatcaaataatataaagataaaactataatttcttta
gtgttaccgtctttatatttttcatcttcttattttttaaccctttaatt
ttattttcattctaccaaaaaaaatttaaaaagcgacttctctcaaatat
taaatgacaagacattcaaccaaatcctatattagacctaagctttcacc
tagtgacttgagcctaggtccaaaagcatcaagtaatggccaaccctcct
aagattttgtaccagaaaaaatatattaaactattagtaacataagaagg
atttatgatacatatggccttaaggtttccttgaccttaataaaagtatt
tctcaaataacgacaggataacaatctattgcacttccagacctcaattc
actagttaacaaaaaacaagcccctacttcagcactcgttcaagttaatt
tccaatcatcacaaaacgatgtgtttggatttgtaacaccataggaccaa
ggataccattaatggactcattccctgattttgttaaaattaatgtgaac
aaactgaggtgattagatcactggagataagcaagtaaggccagcaaagc
gctcttcatagcaatttaagtatttgctctaacccaaggcatattttcct
gcctaaagatattgatagctcttcattttcagacctgactaccacttaag
tcaactttgaagcctcaattctaattcagtatcttttatcatcacttctg
ttccaacaacaaaatgaataaataaagtaaatagagaaaattgcacttac
ataaaaataaaagcatgatttatgcatacaattaaaataagacaattgtt
cgagttgttggctttatatgtcttaaattaccttgactggaaatgtgccc
ggtggcagtttagttgtcaaaatctcccttaatctccttataggcttgac
tttctgggctaatatgtcaaataaaggcaggagttcctctgtctttaaaa
ggaaatctggtgttacccataaaacagtcccacacccttcttaatctcca
ttcctgtttatcatcactatggccccccttcttctcctccttgcggtttt
atctttacgcctcttgcctcaatagtatcttcctccgcaattcaaacatg
atctaaattacaccttggtccgattgccacccccggacccattttgaaaa
cttcccccctttgatcaccagatttacccggttctggacccttttattcc
tgcaaccactcttttctcctaaaaaactttgattcatcttctagggcccc
ttaacctttttgacgtaaaaaaccttttggagtaaaatctggtccttttt
ttttttaaaagcctgttccctaaaaccaatcacggtcttccgggtaaaac
taaacttattccgcatgcccccttcagntgcaaaaccctnatctagggag
aaactaatacccccccccccctttctccctngggacccgcgaaaacccct
tatatctccgagctgcgccccccccttaaaaaaacaacacccccaaactc
agaccgccccccgaagcannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnataacggttggagtatgtcgatcctctgggcg
acgtacagcataaagtagagacgggtccgttactgcggcatgactagcac
ctctgtccggtgctctctgaccacggcttaatccattaccacctctggcc
taaccccggcctctcggtggtacagtaccagtgcctggagcttacatctg
atcggacctccgcggacactctctaatacggtgctctaatagaccgcacc
ttaaacaaaccccagttcatttccaacactcgccctgataatgtctacca
cagtcagtacacgtcgactgtcccgtagcagcaataggagccccaaatct
aatcgtcccatcaactctgacatttttcttaagcttctgaatggaacttg
agtgctttgaatccctcttgctccaacctctctcttggttctggcgctca
gcgcgtttcacttcctcggcgatcttcacgttatcaaccagtgtagcaaa
gtctcgctctctgtgtggagctattaaaacactcagattatccctgagac
tatactcgaagcaaacacatcgctcgtactcagtcgccaccatacctcgt
acatagcggctcagtcacaaaaaattcgacctcatattcggccatcaatt
tatcgtcctgggttaaattcaggaactctctcctacgggcatccacatat
ctggcccccacatatttcccttggaaagcagtcttaaagaactcctaggt
cagttgatcgaactgagtgcccaccttaacagtgagccgccattgataag
cctcatcacgtaccagtaatacaacaccctttaatttctgctcggtggtg
tagtcagatcgtctgtagtcctttctatggcctcaatctagtattcagcc
acattaggggcaactctagcaatacccttaaaaaactcagctctgttaga
tcagagtcgttctgtaatcgacccacagcctccagctctagtattgggcc
tagcgaccatctccagaatatgtaacatagcttgggatagtgtgtcgtcc
ctagccgctcgatcatgagacctagtctcagtcataggtgaagctagtgt
ctcactagtatccagattaggtaggttgcctgatgaagaagacccagctc
gagtccctctacggcctctacaactgtaacgccctaaattttagacttgg
aagtattaggccttcagcataggatcagttaggaggctgcacataaatgt
ttaattatgcaagaaggtgacacaaaatttgcatctgcttcagtggttaa
gggttctaagtgttctggaagtgtctgagaagtcttgggtttaagccttg
gcttgcgtaaaagttttgtttttaaaggaataaacactgtctctaggcag
taggcttttaaataaaaatgggtaaaacatgatagaaaaaagggtctgct
ggtctaggggataagtggaacgtggtagttgcttgaggtctgaggttcga
gtcctggtggggggcagtagagtgttttattttactgctgtgccatggga
gttttgtggtttgattgaaacactgaaaagtttgaatgaatttcaaacta
agtggttgagggaaggatgatcgatttgagtgatttgaggagggatttta
ggagaaaatcaaggggatttgaagctgagggagtgttggtgccgaattgg
gattgtaggtaacccaatgaattctgttttggggttggctttttgctttt
cattttcagtggctgtcactttctttaggtgccaaatttgtgtttcaagt
tttgggctactcattcttcggtttgttgcgttttcctctttgaagctgat
tagtgcatcatgggtacctttcatttttggtctgtctcaacttactcttt
cacaatgccttactgaccgattatctctcatgtccctctctttaccttat
tttgttttggctaaatatttgcattctattcttttctctgcatctctctc
aaatcgggtatgcttttggtcgagtacctttctttccctttttctatcaa
attttccctatccttacattttggttatgtttgctgaatatatcctcttt
ggccgaatatttcatctctcttcttcctgttcttgaggattcgacattgt
catgtgattagacagttagagtgtttggttgttcctctttccctttcttt
ctctctctgcagtaatagtatttccatctaacatttttctttctctgctg
attgctgctaggggtaagattgtttcaacttgcctcggtttcattgtatg
cttttggggtggaggccaattgcttctgtctcctattatcagttctacac
tttcagtaggttgatatacatttggtccaactatttgcaagtatagtaat
agataacaattctctattggaatgtaggtaatctttaaaggttacaacca
atctcttgtgcaagcctcaatcgaacgatcaaggcgtgggataggtaatc
atttgaataagtgttttggtaagggttcgcttcaacttgattgttaggca
attaaccgaaacttctgtttgtgataggttggagtactcgtgggctagtt
gcgcacttttgtaatcaggtgtgtaaaaatactgccctaatcgtaaatca
acaaaagctgaaataggtgaccgttgacgctacatgagcgtgcgctcgct
catgtggtagtccgtatgcctaaacatgggcgtaaaatcattgacgccac
catgagagatttcatgggcttaggctattttgggacattttggaccaaat
tgagctgtgtgggccccacgagtatgtgggccccacacaggtaaaccaca
cgaacgtgtggagaatattgggtcaggctctgtaatctacatggccaagg
ccatttctgggctatgtgggccacatgagtgtgtgggcctacatgagctc
gcattatgggtcttcggcccatttgtactgtttgactgttaagattgcat
agatcgtccgagacgattgtggacctactgttgggttggtaagtatacct
agaccctagattgataaatgactattttgccctcatgtggtaaaataact
attttgcccttatgtggtaaaatgactgttttgcccttatgttatgtatg
catatatgtgcatgtatgaccgtattttagcatgttatttaaactataat
gaatacatgtatgattctatgatatgacatgacatgattgtatgatgtat
tacatagggatgggtttattatgcttggaagaagtgtattatactggcaa
ctctgttgcaaatcactgatggctctaagcctattatattggtagcccta
ctgcaaatactgtttagtgccgcaatcggtgctacttggaatgtagggac
gggtgggttgattttatccccacatggagtgtagggttggacggagatgg
agtgtagaggttggatgggtaggacttgtatactatttactattactgta
ataggccaaggcccgaacatataactatttctgtattaagatgggcaaaa
gcccaaactgatattgtcactgttactaaaaagggttaggcccagactgt
gcttattttctgactgtttgcttatatgggattgcacactgagttttcgt
aaactcacccatctatttatctgtacaggtaatccataagcttaggcgga
tcggtgttgcgagggactcaaaggcagccacacaactgcatttactatca
tatttacttttatttttataagtaattttaatttgagtatttttactgta
ataaggcctctacggatttaactttaatttgggtttttattttctttggc
ttataactgctagagataagaaaactcgagttttctaaagaaataatgtt
tttacaaagtaaacacaagtacgcaactattttaaaaagcttccgcaata
aacaatgttttaaaataaatggcgatttaatacgattaactctttgctaa
acaacttacattttagaaacgaacgagacatcctaaaacaatcatcaaga
tcactgagaggttggttatagaacgtgtttttcaacgatatcgtatttta
cgaaaaacacttcaatgtgacatcgccagatttgatcataacgttccggc
cgggtttgaggtgttacaaccatggcctctagtactccgtccatgagtat
ctctcgtgctcattgtctaaacgtgtttatccagtattaacagttttatg
tatcaatttacagtttcagtaattattaacagatatcttatgtaaaacaa
tatcagtagtatagtttgttttcgtacaacgttgtgtctattagtgtcta
tcggttttgctataatattagtatacactaatttaagtgtttttcaatat
agtctatctatagcagttttagtttaaaacacataacagtttcagagaac
ttacaggatcggtgccggagagtcgatgtaccacatgttcaataaaacta
ctttcaatttcaatcataaaaaataagttctttaaaaatctaaattcaca
gccaagttttccaacctggttctagacgttatggctgaatctggtgatgt
cacatgatagtgcctctgaaaaccataacaatgctaaaatagtttctccg
cttaaacaaccattcctcgtcctatattacttctaaatcgtgtcatttgt
ttccaaaacattattcattcttaaacattatactttacaaatcattacat
tacaaattattattcattttcaaaatgttatacctagcggaagcttttaa
agcagtttgcatatatgaggcattttgagaaaacgttcatccaaattgga
aacccgagttttacctactactagcagttataaaacataaaacagtacat
aaaatctaaattttaaaccaaaaattcatagaggccataattacagtaaa
atacccaattaaacttaaaatcgtaaatatgaagtaaacaatttaaaaga
gatcgtgtgaccaccgctgagtcctccgctgctccgatcctcctaagact
gggggttacctgtacagattaaacagaggggtgagttttcacaaacttag
tgtgtaatccccatgcctataaatagacaacacagtctaggcttaaaccc
tattttggtataggtaccagtctagtttggggtcttagcctgcctaagta
cagaatcagtcatgcagtagggccttagcccattacagtacaatatcagt
aatagatatacagtcacaaaatcttacccagccagcctctacacaccatc
tccgtccaaccctacactctatgtggggatataatcaacccacccatccc
tacacttaataatagtaccgaaagcggcactagacagtaatttgtagctg
agctgccaatatattaggcttaaagcctttcagtacgcttcctccacata
tatcatcccaaccccatgcaatgcaacatacaaccatggcatgctatcac
gtagcgtcatcaaataaacagtatcgtatcataatcatactcaataaaca
gtcatacatgtatcgttcagtcaagtagggatcaatgcactacttatcct
acagtaggttcacagtcgtctcaagtgacccgtgcaaccttagcaaacaa
atcaataaattgggcttacacgcccatgtgatctgctcgtgtaggcccac
acggcctaaattataccttggccgtgatggattacacggcctggcccaaa
atttcatacgtccgtaggggatcctttagatgaccgcagcatacagatgg
nnnnaaaaggnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnacatggggttcagcatcgacatcggcatgggcatgtagta
tacgggggacgtcaatgccccgaaatatatacttgcgggaataaaagaac
caaccacgtctagtgatggcccataatgtagtgatgcttgtgaaaaaaac
atatggttactgaattaaacaggaataagaggatggaattaaccccgata
ttgcgtagtcataggcggtgcatcttttgtcgaagccaacgacaaatcta
ttgtacgaccacatcccctcctatgttattgtgacggtcgacgttgtctt
ttcaattgaatttacatactcctcgcctccagtggtagcaaatacgactt
gtcgatgactctgaaccatgttaactaatcatcaactgccgtcgtgtcca
cctagaaaaatggttcgcaggtggatatggattccatcctacaatcccaa
gtctagatgtgttccttgtgcttctttttccaatccttgtcgttcttttc
gcgcatgtacacattgtgcagttccttcatgtctcgtggtggcagtagaa
tttgttgcctatacccgaactgtggtagaacctggtctggttcatgcatt
ttcaccgttacgtacactattaacggcacattcgtgtctcacatctcccg
attgtccaacacttctgacaagatgcaagatatgatttcggggtaggcat
acgacatccattcaaactgaaaagtagaattgtcaatatcattatgtaca
tatttttttaacgaatcattgcataattaatattaatttgaaaaggatag
gtaattaacctcaatttttgagtgttgatctaacagtagcttcacgtttt
cctactcgtcaggtagtcccacgtaactcggcctatggttccacctttac
aaggtatatattagtcgaaacatattgtaaataaaaaatatttgctacat
aaactacatatttattgataaatgatgtttacctcatcaccaacgggaac
atatatgggttagtcactctaggacttagaaacggtattcgctaccaggc
ctatgactacaacaaaaataggcaaccactaatcgacatcttatctagtt
gcgttgcccgaaaaagctccggtataatatggataacacaacaaatccct
aacttagttttgcgcatccagtaaagtccactagatgtagaaaccacctt
acgtgtaccaaatttctaaatttatcaggcattaaaatgcccccgattaa
cctcatgatgaatgcttgggcgtactattgtatgaccttctccgttgcgt
cgtcgggaaacttattgaaaattttttccaaccaattagtctatattcga
ccacctttgaacttgtttgagaccttcctcaacattgttgtgcaaaggtc
cactttccctcgaaccactgctgatcctgtgataacaaacccatcgaccg
gcaaactgagttgtaacgctacgtcctcgactgtaattgtacactcacca
catagaaggtagaaaatatgtgttttggctctccatctttccaccggcac
gttgattagtgtgggatgaagtttgcagcccccttgcatgtgtgacgcat
gtaagaatctaacctcctacaggtacccacaaatttcagggatcagaggg
tccctcgtattatgtatgaacgcctccagcacaacgattatctgcctatt
tataacataaaaaatatttagatttggcaaaaaaattttaacatagttaa
aaataacgaaattttaaatttcatcttaccattgctaattggatggcaaa
aatatggttttcgtcaaagcagattagagaggttaattcttgagaaattg
atcccaacgaataaaataagatataactaaaaaattaatatttttaaatt
aaaatataaataaatattgaataaaaaacttgagagagttgagagaattt
aagagaggatatatgtgaataaaaaaaataaaatttgagggtatttataa
gttaaaaaataaaattaccgttgggattttaatttttttaccatttgatg
tgacaatggataaaaagaattattgcattttatttatcgttaagggaaaa
cacatctagttgaacgcgttttctgcacagatgcaagaaagcgcattcaa
ctaagcacgctttcactctctcttctaaaacctacatatttttctaatta
aaatttaaaacgatttaaaagcctaattaaaaaaattaacatatttttca
aatctaacctctgaaatgtattagaattaatttatctattttatcaattg
tgcctatatacaatcttcctctaatttccatacttagtaccgattcaaag
aagtattctattttatgtttaaaatcaccttgttaaattagtaatggctt
cttttgtaaccaacaaattaccggaattctgttataaagagggaagcgtt
attggtttccctccaaaaaactcatctctctcatcttcttctttctctat
tctattctttctcttctaaattctgttggttcaattgaggctgcatctgg
gagagatctgagctacgtattgaattttgaatgaggaggcgagtctatgt
ttcgaagattcagatcccgacccgtcggatcctgtttcctcaaattgacg
ttaaccgtccgatttagcttccctcccccccctctctctctctctctgaa
gtttcaacttctacgaagccaatttgagaaggaaaactttctcgatccgt
tggcgtttcggatatttatttgcatgctgcgcctgcacctgcttcttcag
gtttgtgtttctttctttcttcttcttcttctttttctttaacttttgtt
tcttttttgtttggctgcctggaaaatgaacgaaagtaaatgtagaagga
aggaacataaatgaatatagttggtggttattggaacaaaacgtgaaatt
taacttagtgcaaactagtgaaaacttttatgtttgattttcttttttta
ttttgtgtaaatttcatattctgatgtaaaaaaataaatatcaaaattct
tgtgctaatatggaaattttacttattgaagctcatttttgtttacttct
cctttatgggggtcgcatttacagatttgaactccatggaagctttaact
tctttgtaaatggaaggataaaaaaacgaacgtcatttgagcagatgtaa
aaaagttttacagatttgaactccgtggaagctttaacttctttgtaaat
ggaaggataaaaaaacgaacgtcatttgagcagatgtaaaaaagttaaca
cattgccaattattattatcatttttaaactaaagctagtattgaagttg
catagcaaagcctaaaagccctaataagtagttgtggaaccttattaaaa
tttggatcgattatcttaaaatatagcgttttggagaatttgagattaag
gtgggagtttatttttgttaattatttatgttttcagtgatagggtattt
tggacatggaggaaacgatagtgtagtacgtagcataaacctaagaagag
agtcaagtataatggannnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnaagaagataatcgagctcgtcctaatggccagtc
cccacgagagtaactggatttgtggctaagtgtctgacatgccagcaggt
taaagctgagcatcagttgccttcgtgattgttgcagccagttaagattc
cactttggaagtgagagcgagtgactatggactttgttagtgggttgccc
gtcacccctactaagaaagattctgtttgggttatcgtagatcgattgac
caagtccacccatttcatacctgattcgcactgactactctctgcagaaa
ctagctaagttgtatatgtctaagatagtgagactgcatggggtaccggt
ttcgatcatctctgatagggatcctcacttcacgtctcggttctggaaga
agctgcatgaagctctgggtactagattggtcttcagtactgctttccat
cctcagaaaaatggtcagccaaagaagctgattcaggcattggaggacat
gttaaggagttgcgtcattgatttctgtagcagttgggaggagtacttgc
cgctagtagagtttgcttataacaacaattatcaatctagtatacagatg
attacgaggctttgtatggtcataagtgtcgtactctttcatgttggact
aagttgggcgagcagcgtgttctgggccctgagctagtttctgagactga
ggataaggttcggctgattagggattgtttgaaggaagcttctgatagga
agaagtcttattctgatctgaagaggcgagagattgagtattctgtgggg
gattttatgtttctgaaggtatcaccttgaaagaaggttctgaggtttgg
tagcaagggcaagttaagccctagatttattaggtcttatcgcatactga
aacgagtgggaccggtcacctattagttagagctacctccagagttggat
cggattcatgatgttttccatatctcgatgttgaggcgctaccactcgta
taacagctcgatttagggcttagtcagaatagtggtctcgggaccacaaa
tatgaagtcaaaaaaattattttattattattttggagctattgcatgtt
tatattagtgtatgaaaaatttggtaagttaattttgacgtttgcgagtc
caattgcgagaaatgactaaatcgcataaaatgaaaaagtcctgaattga
tagttaaaggtgtcaaatagctagagagtaaatattgagggtctttatag
ggcaattagaccctattttgatagcttggccaaccatgagagatgaaaat
gttcaaaagtcaacattaggtaagtttgataacataagatgtaatataat
aatatctaagcctagctatcatcttttttctttcattctctcttcatctc
cactgatttttcagccattgttaagggttttgagcttgaaattttcagta
acttgtaatcctcacaagtaagtgatttctataccctttgtagatgattt
ttgtatttttgagacccttaaagcaaaagctttcaaatgggggtactatt
ttgaaaaatgattaagagtttagggtttttccatgaaaggatttgtaatt
tttgctgagtttttatagaataaagaagtcttgagagtgttataaacaac
ttttgtgaaaggtgttagcatgaaaacacctaaaatgaccattttgcata
agttgtaaaatagatgataaatgtgtgaaatagtgggaatttagagttgc
tataggagtaaaaaaggtttggctaagcttaagatacgaataaatttgat
aaaaatcgatttacgaacctagaggtgaaatgtttattttgtcaaagtct
aggggcaaaatggtcatttcactaaagaagtgaaattttgattgtctaat
tttaattagtgactagaaaagtacatttttttattatagattaagaaata
tcgaatctaaacttagatcgggggaaagccaagcaaattgattaagtcga
ctagtcgccacattttgtaatccgaggtaagttgtatgtaaaaaatacat
gtaacagcctaattttcagtggtgtcggaatagtgattcgagatcactaa
atccgacaaatgagtaggaaatattattaatttagtgagtataagttaaa
tgtgaagttaggaaaaatttgaaattgtgaaatgtacaaatatatatata
ttaaaataattagaattgaaaacgaggtatcgagacctcgagaattttaa
atcaagccataaatatttttataaatatttatggagtgttaataagttag
tattaaagtttcgtcaagaaattttaaagtactgatagctaattgaacaa
aaaggactaaattgtatcaaatgtaaaattgtgggaaatgattaaatagc
ttaaatgataaaagaaagacggtttaaaaggcaaataaacccaaggtcta
tttgggctggacggcaagagcatgcaatcaccaagaaaataagggtaaaa
ttggaaaattgcaaaattcacttaataaagctaggactaaagtggaatta
tctagatttctctttatttttctgcattctcatcagaaaaaacaccatgg
aagagttcccttaagctggtttttcatatttttacttcaagtaagttcaa
ttcttgattattacttgaaatttttgtgtttttgtgacttttacaactag
gtccatttgttgaattcattagttcttgattctatgaaagaaattgaaag
tttatatgaatatgtgctggaagtatatgatgatttgacatagaattaga
gctttaaattgtttatatgttgattttattgaaagaattgaatagaaagt
gaatgtttgggacctaaattgtaaaagagtttgaagttagagttttatgt
ggaaattctgaatttcaatagttatgaaataacttataatgtctaggaaa
agtgttaattgagaaaattagtttaattgaggggttaattaagtaaggac
tgaattgtatgaactgtgaaatttggggcaaaatgaaaatcaacattttg
cactaaaacagttttggacagcagcaatagtctaactttgaaaaatctca
aaaaattgtagaaatgaaattaaatcttattgagtttaatttcttataga
agaaattatgtaagaaatgcaattttaaattatgagatataataaatttt
gtgagacaaggtcagaatgatttcaggttcccctgttctgactttggaaa
ataataaaaaattggataaaaataattaggggattaatttatatttttag
aatcctaaatgagtctagtttcaatataaataaacgggaatatcattcga
attttttatgaagagataatcaatttttagtgaagaagggtcagaacttt
caaatagcagaacagggataactttaaagaataaactgtacttattggct
aaaccaaaaattatgaaaattttatggtaataatatatatgagtctattt
tcagataaaattataggatcctaatttggatttctatagctctagatata
aataatttagtgactatgacacaaatggacaattttaatatttataaaag
caaataataaagattatagataatgttacttacaagtgtgttatataaat
taaggatgtggaatggagaggaggaggaggaaaatatgtatgaatattca
gctagcatggctaatttgtatgttttaggctcatggactaaattgaataa
aagtaaaattttatgggcaattttgtaaaaaaaatgttagaaatgaccaa
tttgcatgaaatggattattttattatttaaattaaaaaattgaatgaaa
ttattagtttagctcaagatcagggaaaaacatgttttaagggttaaatt
gaaaagtgttgaaattatggaaaattctgacattttatagaattcatagg
ttgttatcaatttgtgtgagaataacggctggaaataaggattaaatttg
caattattttattttattttaacctaaggacgaaatcgtcattaattaaa
agtttaggggtaaaatgataattttgtttagagcattagttgaatgtatt
ataacatgaaataaatgaaaacgacgatcaaatttctttataaagatccg
gatgacttgaatacgagacttgaacgtggaaaagaaaagatatcggatta
ataaaatatctgataaatgaatcggtaactctggtaatgctctgtaactc
tattccggtgacgaattcgggttaggggcgttacaatacaagtataatgt
caatgtatgtgttgaattgtacttgaatttaatatagcatgaattgtttg
attgtggaattgaaaaagcatgatagtaatagagatagtaaagttctcgt
gtgaacctaggaaataaatcagatattcatgccataacacatgggttatt
gtgagttagtgttagacatgtctgtgacatgcatcggtcatattatggga
gccagtgttagaccatgtctggggcatagcatcggcattaagacgagagc
tagtgtaagacatgttagggacatgtatcggcctcgagacgtaagccagt
gtaagacatgtttgggacatgcatcagctatgaaatttgttagtgtaaga
ccatatctgggacatggtatcggtacggatatgctagaacttatgtaaga
ccatgtctggaacatggcatcagtacctgaccccatgtttgaggctaaat
gagtatttggtaatgttccaaatggcttaacagtgaaagtaagattccaa
gttaacaaggaaagtttaattgtgttgtgagtggcacaggtacctgtatg
aaatgtatgaaatgtgagctcaatatatgctatatggggtgtattgaata
ttgatgagtaacttttgcttattccatttgtgtattatgatacttgttga
ataatggtaaagttatgttgtatatttatttatttgcaactaactaagct
ttatgcttactccctctctttttgcattttcttatagtaccgcctatcta
gctcaaggatcaatgaaagtcagatatatcgatcacactatcaatcgaag
cattcggtatagtttgatctataattttgaatatggcatgtgtagggctt
agactttactatttttgtgtcattgaaaactagccaaatgtgttggcttg
ggttgggaacccttcattttgtattaagcctcaaaagatggctaatattc
atttttgatttttatgtaaagatgttattttcagggttaagtaaaataca
taaatggaatgttgtctattgtgactgatttggttgcatgaaataatctt
atcttgattgtggttactattatataggttgtgcaagtaagggtggcaaa
taggcttggtaaatagccttatattttctacacgggtagacacacgggcg
tgtgtctaggccgtgtgtgacacacggcctgtcctatgggcgtgtgatcc
ggccgtgtgtcccctgcacgtaaaaatttcaagtcagtatgcataatagt
aaacatatgggcaaagacgcaactgtgtgtctcagtcgtgtgagggatac
ggcctagtacactggcatgtgccttggccttgtgactttatggagatgct
gacgttagaaacataatgtctatgtttttgcacacgagctaggacacggg
cgtgtcatggtcgtgtgaaagacatgagccaggaacacgggcgtgtgcca
agccatgtgaaaacccctgtaggtgtgcatttataattaattccatacag
gtagaggacacaggtgagtccctgtattgcttaggctgtgtgagctacac
gggccatcaatatgaccatgttgaaatagccacacgggcatgttgccctt
ctacacgggtgtgtgccttgtttcaaagtcaaattttctatagatggttt
aatgaactagattgattctgaacaattttcgatggccgatttaaggctcg
taggcccacagtaagaagcttaaagtagaaatttaaaaagttctaatttg
gaccaagtctcaatgactgggagaacgtttgtatgcacgagatcgagtta
ggtaatgactcgtatttcgctccagcgtgggttacaggtatgggttgtta
catttagtggtatcaaagctatggtttagtcggttctagaactaacctaa
tgagagtacgagtctagctatacatgccataactgttattgatagtgtga
caacttttgactattataaattgtattttcatatagtaaatggatcatga
tagagccacggcggatgacgtggagagtaacgtgctggctcttgctgaag
ggatcgcgccagttgagagtgaacccgtgactatgggccaagacggaggg
cctagagaagtctatctctgaatgatagatgcttggtatttggagtttgt
tcatgttaatctgaacaatccacctccttcacctcctctgattcctcagt
atccctcggtagctccgcaggtgcagacttgattagaagagagaagcctc
cgatagacaagattaggaagcaatggaccgtggaaatttgggctaacatg
gatgacgacccggagaaagtagagttttggctagaaaataccatcagggt
aattgatgaactgtcgtgcatgcctgaggagtgcatgaagtgtgcagtat
cgctcttgagagattcagcctaccagtggtggaatactgtcgtgtctatg
gtaccgagagagagagtaacttgaaaatttttccaggaagagtttcgaaa
gaagtatattagtcagatgttcatagaccagaaaaagaagaaatttcaag
agttgaagtaaggtagtacgactgtgacggagtatgaacgtgaatttgtt
aaactcagcaagtatgcgcgagagtgcatatccactgaagctaccatgtg
taaaaggtttgaggatggtctaaatgaggatattcgactatttgtttgca
ttttagagctaagagaatttgtggtgctcgttaagagggcatgcaaggca
gaagaattggttaaagagaggaaaaaggcggctatttagttgcgggattc
aagaaaaagacagatggagaaatcacatcagtctccatctaagaaatcta
aggaattccctatccgatcgaatactttggccgggttctcgaataggatc
aagaacaagcagaacacgacctctagagcctaggccacctctatcgcgag
tgtcggcagtacttggccaaataggccagagtgtttacattgtggtagac
gtcattttggcaagtgccgaggtaaagaaagagggtgcttcaaatgtggg
tcactggaccacttcatccgagactgtctcaaaatagaagagagagagag
agagagagagaaagcaagaagtgaaggcaagtagtactctattgaggggt
agaccacaaaagaactctagaagcggggctgctagtagaagtgcgccaag
agatgctgtagtgaggtccaagggcaaagcgcctgcaaggacttatgtta
ttcgtgcctgtcaagaggcagagtctcccgacgtgatcacgggtaccttt
tctatccatgaaatatttgttgttgctttaattgacctagggtctaccca
ctcttatatttgtatggaactgatacctcatatgaacatgatagtagagt
ctaccgaaattgtaataagagtgtccaaccttttaggcagacatgttcta
gtggaccaagtgtgtagggattgtcctttaacaattaaaggtcattgttt
tctgggtaacttgatgttattttcgtttaatgaatttgatgtaatccttg
ggatggattgattgacttttcacagtgttgtagtggattgtaggagaaag
gttattgagttgaaatgtgaagacgaaaatgttcttcgagttgggccaga
tgaatcgtataatttgcctgtaatagcatcgtctttgactgctgagaaat
atttgagaaaagaatatgaggcttatctcacttttgtgttaaatactcta
gtatctaagttgaagattgaatcggtaccagcggtttatgggtttataga
tgtatttccggaagaattacccggattaccttcagtgagtgaagtagagt
ttggaatcaaattgataccgggcacgacacccttctcgattgctctatat
aggatggattctacggagttaaatgaattaaaagctcaaatacaagattt
aactaacaagggctttgcaagaccgagcttttccccatagggtgtccggt
gctctttgtgaaaaagaaagatgggtgatgaggttatgtatcgactatag
acaactcaataaagtaacagtgaagaacaagtatcctttgccaaggatca
atgacctgtttgatcaattaaagggaggcactgtattttccaagattgac
ctgaagtcaggatactaccagttaagagtgaaagagcatgatgtaccgaa
gactacgtttcgggcaagatacgggcattatgagttcctcgttatgccct
ttggtttgactgcattttatgtactgcatttttcagccgtatttggataa
gttcgtggtggtctttattgatgacatactgatttactcgtatgatgaga
gtgagcacgcgaagcatttgaggactgtattacagaccctgagagacaaa
caattgtacgtcaagttcagtaagagtgaatgctggcttaaggaggttgg
atttctaggacacattgtgttgggtgacgggattaaagttgactcaagca
aaatctcgactattgttgaatggaaactgtcgaagaatgtgacagagttc
cgaagctttttgggtttggctggatactataggcggtttgtaaacggatt
ctctatgatagctaccctgatgacaagaccgctgcaaaaagatgttaagc
tcgaatggacagaaaagtgccaacagaggttcgagcaattaaaggctttg
ttgaccgaagccccagtgttagtgtgactggagtcgggtaaggaatttgt
gatatataactacgcctccttgaatggtttggggtgcgtgcttaagcaag
caggtaatgtgatatcctatgcctcaagacagctaaagccacataagaaa
aattacccgacgcacgatctggagttggccgctattgtgttcacattgaa
gatttgtaggcagcatttgtatggagagaaatgctgagtattcaccgatc
acaagagtctcaagtatttgatgactcaaaaagagttgaatctgcggcaa
tgaaggtggctagagctgataaaggattatgagttggtgattgactatca
tccgagcaaggcgaatgtagttaccgacgctttgagtagaaaatcattgt
ttaccttaagggccataaatactcagttgattgtgtctaatgatgattcg
gtcctagcagagttgagagctaggccgacatttctacaagagatctgtga
agctcagaaaggtgataatgagttgcaagctaagatggatcagtgcgaga
cgggaaaagaatctgaatttcgtattagtacagaagggtgtataatgttc
aaagatagagtttacgtacccaaggacaatgagcttatacaaaaaaatct
acgagagacacatagtggttgtttgtccattcacccaggcagtgtaaaaa
tgtataacgacttgaagaaaatgtattaatggtcagggatgaaaagagat
atttcagagtttgtttccaggtgccttgtgtgtcagtaagtgaaggctga
acaccaagtgccttcaggtctacttcagtctatcatggtccccgagtgaa
agtaggatccgattactatagattttgtgacaggtctgccgataaccctg
aagaaaaatgatattgtttaggttattgtagatagactaacaaaatcggt
acattttataccaatgcgtactgactactcccttgagagattgactgact
tgtacgttttcgagactatgagactacacgggttgctcatattgattatt
ttagatagagacccaagatttaccttgtacgtttttaagaggctttagga
acaaagttgatttttagcacggcatttcacccacaaatcgaaggccagtc
agaaagagtgattcagattttagaagacatgttacgatgttgtgttctcg
agtttcaaagcagttggggaaggtaattgccattggttgaattcgcctac
aataatagatatcagtcaagtttgaagatggcgctttatgaggcttggta
tgggagaaagtgtcgaacgcccttatattggactgaacttagagagggtc
agattcacggggttgatttagtcaaagagactgaggagaaagtcaaagtg
attcatgactgcttgaaggccgcctcggatagacagaaatcctacgcgga
tttgaaacgaaaggaaattaagtttcaagtcagtgataaggtacttttga
aagtatccccgtggaggaaagtccttagatttagtagaagaggcaagttg
agtcctcgtttcataggaccttatgagattatcgacagagtaggatcggt
tgcctatcgattggctttgccaccagagttgaaaaagattcaaacgtatt
tcatgtgtccatgctataccgatatagatcagacccttcgtatgtgattg
cgccaacagaggtggagattcttccagacatgacttatgacaaagagccg
gtcaagattttagcttgagaagtcaaatagttgaggattaagagtattac
actcgtgaaagttttatggcatagacatagagtcgaggaagccacatggg
agacccaagagactaagaaagaccagtaactgaacttattcgccagtaag
attttcgaggacgaaaatccctaaggggagagaattgtaacagcttgatt
taaggcctagtcagaatagtggtctcgagaccacaaattcgaagttaaat
aaattattttattattatggagccattgcatgtttatattagtgtatgaa
aattttggtgaattaattttgacgtttgcgagtccaattgcgagaaatga
ctaaatcgcataaagtgcaaaagtcatgaattaatagctaaaggtttcaa
atagctagagagtaaatattgggggtctttatagggcaattagaccctat
tgtgatagcttggccagccatgagagatgaaaatgttgaaaagtcaacat
aaggtaagtttgatgacataaggtgtaatataacaatacgtaagcctagc
tatcatcttttttctttcattctctcttcatttccatcaatttttcagcc
attgttaagggttttgagcttgaaattttcaataacttgtaatcctcaca
agtgagttccataccctttgttgatgatttttgcatttttgagaccctta
aagcataagctttcaaatgagggtactgttttgaaaaacgattaagagtt
taggattttgccataaaagaatttgtaatattttctgagtttttatggaa
taaaataagtcttaggagtgttataaacaacttttgtgaaagatgttagc
atgaaaacacctaaaaggaccattttgcataagttgtaaaatagatgata
aatgtgtgaaatagtgggagtttggagttactataagagtaaaaagcgtt
tggctaagcttaagatacgaagaaatttgataaaaatcgatttgcgaacc
taggggcaaaatggtcattttatcaaaaatctaggggcaaaatggtcatt
tcaccaaagaagtgaaattttgattacctaattttaattagtgactaaaa
aagtacattttttattatagatcaagaaatatcgaatccgaacttagtcc
gggggaaagccaagcaaatcgattaaatctactagtcgacacattttgta
atacgaggtaagttgtatgtaaagaatacaagtacaatgtcaatgtatgt
tttgaattgtacttgaatttaatatagcatgaattgcttgatattggaat
tgaaaaaacatgatagtaatagagatatttgagttctcgtgttaacctaa
aaaataattcggatatcatgccataattcatggggtaatgggaattaatg
taagacatgtccgggacatgcatctgcctaaaaacccagccaaggtaaaa
aatgttggaacatgcatcggcaatgaaaaggttagggtaaaacacgtttg
gaaaataaatcgggaggattatctaaaactttttccaaccctttgggaaa
ttgcttacaaactgacccatgtttggggtaatgaatacccaaaagttcca
ggggtcacagtgaaataaattccctttcacggaaataatgggtggtgann
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaa
gtgagactaaatcgagccggtccaaatagtagcaaatcacaataagttaa
aagttatacaatatctaaacaataacaacaaaataataatcacataatag
tgaaatggtagcaaaacagtgagaaaacaagaagaaaacaacaaagtttt
tctttttgcaaattcgggctaggtcgggtccaggcaaaaaaaaatacttt
actcgaggcccgaactattttttaaacgggccttatttttatttccaaac
ccatttttcaaacctatatttttgccttaaccctctcataggcaagtcta
gtcccaacaaacatagttgttcttgaatgacaaatgttccaaacaatagc
tattcttaaacaaaaattattgtaaacaagagctattcttgaatgaaagt
tgttctcaatggcaactgttctaaacaaaagttgttttgaagagagttat
tttgaatgtagttttctcaacaaaagaacaatcactattctaaaattgtc
caaatactacattcttgcattctaccacacaattttgctgaagtgtctta
ggtgtcgagaactcatgtctgatcccctctttgtcacagaattggacaaa
ttcttcattctcaaattcatttccatggtcactgcgtatctttcttacca
tcccaatgatatttccttattcattaatcaaccccctgcatagtctctta
gattcatcaaatgcattttgatttttcgctaagaaaccttaaccaagtat
acttggagtagtcatcaacatacacaagtgttggaaaaaatctggttcaa
aaacaatcttcttacacagtgaaaaattaaaattttaaaaattgactcgg
tttgtaatatttatagcaataaaccctttactaaaattgcatctgtgttt
ttggctagattgatccttatcgttcccagctttcaactgaacaacctttt
ctgctattctcatgccacgaactactttgagtgtgggctcgaacaaattc
aaatcaaacacacaactagaaattatttactttacttttagtagaaaaca
aatcccttttcaatagaaaccggtagaattgttatttcgaaaaatagaat
ttatacttagaaaataaattctcactatttttgggtaaagtaacaatatt
tcaaagttgtatggtgtcatttatttatagagagagaaagtgaaacgctt
gttgaattaatagaagtctatttcaatagaaaaataaatcctaatctaac
taggattgggggttgacaaccctagttaaatatactagggttagccgtcc
caatatttagcatgagaggcttgagtctttctcgtatcgggttcaattat
aagtacttcttggacatttaaccaagcactttataagtcaatccaaccta
atatatgtttttctattttccaaaataaacatcataaattaatttaaatt
aattaattaatttttcaattaaataatttttttaacttgattataatccc
gttaaaattattgcaactttaccaaaaaagaatctatgagaaaatatatt
taatttttctacatttaacggtttcactatgaccaattaattttatttta
tttttgaacttaaattaattaattaatacttcaaaaatccataaattaaa
ttttcaagtcatttccatttagagagaaaaccacattcattttcgaatgt
ttcctatttctccaactttaccatttctttttatttgattcaacatgcaa
ttcaattctggtttcaacgggctagcaaagggtccgattgaacatatgtg
attaaggcttaaatgatttataattaagttccagcttttcgcctattaat
tttaaactcatttagtcacgaaattattccactatagtatcgtgattgag
ctctccctaatgtcataccattataaaagcaactcgatcagtgcttgtcc
aatgaccttgtcgtaagtgtgttaccttaataggatatccttaatctttt
tgggataaatccactcttccaatgtgattctgttttatctcatagtaatc
attacatcttcctttatgaaaagttaattactatcaaatagtaattaagt
ctttcatcataaagacgaatgatctgtggtaaattctgtttatattttta
catttatctacaaagcttaagcctcccctatcctgatctctcttcctagc
tgctagaatctcaccgagtttgttactgctggtagtaaacgtgaaattta
caagcttaccttaaacatagagttgactggtactcaccagattgactttg
agatcatatacaagcaacacattcttcaattggggtatacctgaaacatt
caaaatccatttaccaagtatttgacctttattcccatcaccaaatgtca
ctcttccaataggacaatcttattagtgaggtagaactggttacctgcca
tatgttgtgaacaaacattgtcaaaataccaaattccatcaatagtggac
tttaaggaataataagaaacaagcaaacatttattttatttcttcattca
tacgctctttttgcacttttttagctgcagtgcctcggggagtgggcact
gtcttaggcactgaattcctccatttcaaatcatgtagcatcctaaagaa
atgtggttttatatggctaggggcactgcaatagtggcaaatcaccttat
gggaatgaatattcttcttgaatgatttggataacactgatttagagttt
ttaccaacttcccttgaacttgtggcttttataaaaattgtgagacttcc
tattatagttttacatttatctacaaagcttaagcctcccctaccttgat
ctctcttcctagctgctagaatctcacgagtttgttattactgggtagta
aagttcttaagcattagctcagtttcaaaaagctatttcttaactttcac
aatattgtctcattcctttgcaatgagaacttctttagcagttgtttaat
caaagttgcattatcatctttccattgcttattatattaggataattgag
ttttgatttcacataccatttcccatttgcctaaaatcaatttatgtctt
taagaaattttcatcagtcctaccattgtattctttatcagaatcttctc
cactaattgtacttgtaacaccccaaactcggcctagacgttatggctga
atctggtgatgtcacatgatagtgcctttgaaaaccatgatgatgctaaa
atagtttctccgcttaaacaaccattcctcatcctatattacttctaaat
cgtgtcatttgtttccaaaacattattcattctcaaatgttatactttat
aaatcattaccttacaaatcattattcattttcaaaatgttatacctagt
ggaagcttttaaagcagtttgcgaatatgaggtattttgagaaaacattc
atccaacttggaaacccgagttttacctactactagcagttataaaacat
aaagcagtacataaaatctaaattttaaaccaaaaatccatagaggtcat
aattacagtaaaatacctaattaaacttaaaattgtaaatatgcagtaaa
cagtttaaaagagatagtgtggccaccgcagagtctttcgttactccgat
cctcctaagtctaggggttacctgtacagattaaacagaggggtgagttt
tcacaaactcagtgtgtaatccccatgcatataaatagataacacagtct
gggcttaagccctgttttggtatcggtatcagtccagtatagggtcttag
cccgctcagtacagaatcagtcatgcagtaggaccttagcccatcatagt
acagtagcagtaatagatatgcagtcacaaaatcctacccagccagcctc
tacacaccatctccgtccaaccctatactccatgtggtgatataatcaac
ccacccatccctacactccataatagtaccgaaagtggcactagacagta
atttgtagctgagctgctagtatattaagcttaaagcctttcagtatgct
tcctccacatatattatcccaaccccatacaatgcaacatacaatcatgg
tatgctatcacgtagtgtcatgcatataatcagtatcatatcataatcat
gcttagtaaacaatcatacatatattgttcagtcaattagggatcaaaac
actacttaccaaccccacagtaggttcacagtcgtctcgggcgacccgtg
caaccttagcaaacaaatcagtaaattgggctcacacgctcatttgatct
acttgtgtaggcccacacggcccaaattaatcttggctgtgtggatcaca
tgacctggcacagaatttcatacgcctttttggtttactcatatgggtcc
acacggctcacttggctgagctcatgtgtcacactcgacctcacccagcc
ttcacatggctgtgtcatgtacgcacagcctggctcgtcgatcacacgcc
cgtgtaccgtcacacagcctaccacacgggcgaccacatgcccctatggc
atcgacattaagctttttgagcttttcactgaactctattttctccattt
tgggtacacacctggtatcgattcgtagctaaaatcaccacgagcccttt
agaacctattattgactaacattttgcttaattagtcacttaaatgatca
aattaaacttaaccccaaaacaaaaagtcatcttccaagcgaaaaaacct
ttaccttacgaactaaggatgcttccctctataactcgaaactagcacct
tccctcacactagattttcggctgacaatacagttaaacagaggttcctc
aattaataacttataaactaaaattttaaagcaccatcatcacttaccga
acgagtgtgactctatgttgcgcgatatgacgagttgagaataaagttga
ataggaaaatggaggaaaaatgtggattcaacaaaagaaagggtaaaatt
cggcagcagtgtggagaggagaaggagaaaatttggcaaattcttgggaa
gagaaaaaaatgaccaaaatttgaaaaatcggaattccctcaatcccaca
ttttcctcctaatatcactcccttactcccataaccgttcactagcacca
gaattttactaacacacaaacacctacacgacacatgcagtaaaattaaa
tccctttaatcgcgcagagattcaaaccccaaacctccaaccacttaaca
ctaacttaaccaccggaccagcagacccattctgacataaacttactaat
atttaaacttaagcctactggacaagagtatgactttattcatttaaaaa
caaaaaaattttgctcaaatcaaggcttaaacccaagacttctcacacac
tcccataatacataaccactaaagcagatacattcttgtgtcacatttta
acagaattaaaaatataaattttagggcgttacaactctaccctctaaaa
ggaaatttcagcctcgaaattttacctgatcagaacgtataaggatattg
ctgacgcatcgcatcctcaggctcccacgtggcctcctccgagctatgat
tacgctagtgaacattaacccagtggaattgactttttcctcagagcctt
tacatctctatccaatatctgtaccggctcctcctcgaacgtcagatctg
acctaacctcgatctcctcaactggaacaatatgcttgggatttgagctg
taacaccccatacctgtaacccaagctggagcggaatacgaggcattacc
taactcgatctcatgtacacaaacgttcccccagtcaccaagacttggtc
caaattagaactttttcaatttctacttaaacttcttattatgggcctac
gaaccccaaatcgaccatcaaaaactattcaaaatcaatcttggtcctta
aaccatctatagaaaatttgactttgaaataaggcatacgcctgtgtaaa
agggcaacacgcctgtctagccatttcaacatggtcgtgttgatggcccg
tgtggctcagacggcctaaacaatacagagacatgcccgtgtcctccacc
aggggttttcacactgcctggcacacatccgtgttcttcgcacggtcatg
acactcccgtgtcctagcccatgtgcaaaaacatagacattttgtttccg
acgtcagcattcccataaagttgcatggccaaggcacacgcccgtgtgtt
aggttgtgtccctcacacggctgagacacatggtcgtgtttctgcctgtg
tgtttactatcatgcatactgacatgaaatttttacgtgcaagggacaca
cggccggatcacatgcccataggacaggtcgtgcgtcacacacggcctag
atacatgcccgtgtatctacccatgtggacaatataaggctatttaccaa
gcctattttccacccttacttgcacaacctacataatggcaaccacaatc
aagataagactatctcatgcaaccaaattagtcacaatagacaacattcc
atttatgtattttactcaaccctgaaaataacatctttacataaaaatca
aaatgaatttagccatattttgaggcttaatacaaaatgaaggattccca
acccaagccaacacatttggctagttctcaatgacacaaaaatagtaaag
tctaagccctacacatgtcatattcaaaaatatagattaaactatattga
atgcttcaattgatagtgtggtcgatatctttgactgccgttgattcttg
agctagataggcggcactataagaaaatgaaaaagaagagggagtaagca
taaagcttagtaagttgcacataaataaatatacgacataactttaccat
tcttcaacaagtatcataatacacaagtggcataagtaaaacttactcat
caatattcaatacaccttatataacatatattgagctcacattttataca
ttctatatagatatctgtgtcactcacaacacagttaaattttccttgtt
aacttggaatcttactttcactgttgaaccatttggaacattatcggata
ctcatttagcctcaaacatggggtcaggtactgatgcaatgttccagaca
tggtcgtacacaagttctagcatatccgtgccgattttatgtcccagaca
tggtcttacactaacacatctcatagccgatgcatgttccagacatgtct
tacgctggcttgcgtctcgaggcagatgcatgtcccagacatgtcttaca
ctaactcacaataacccatgtattatggcatgaatatccgatttattttc
taggttcacacgagaactcaactatctctattactatcatgctttcgcaa
ttccaatagtctgcaccatcacctctaagctacaaggaggggatccttta
gatgacctgcaggcagcagttggtnnnnnttaagaannnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnttttttatttgtct
tttatttatggtcttgaaatttttttttttaaaatttttttactttgctg
tgtagaaaagtttaattttgatgagaatttttaaattttaatttgcagct
gtaaggagcaagatagcgatggaccactaaagctaaggagtgtgtgatta
atttatgaagtgaatggttgagaatttgagagtgacaaattagtaaaatg
tgtttcttcttctttttctgtgttttcctctgattggttcaacataaagc
aactttcaagctttctgtgtcagttcaatactttcatgtgatcatagttg
ccattctttagtttggctatctcataaaagaaaagaagttgaataaagta
gaagaagaagaagatggagccaacaaaccagaagtttttggaaagagttg
tttcacagaaagctctgcaaatgggaagttcattcccatgccaaatttgt
gtggtgggttttctctgtggagtttgcctcacttcttttttcttggctgt
tcttacttctgttggtacctttggctttactgggatttcattttcatcct
tatcaatggggaattctccattgaattcaagttctgagattatcagtaag
tcaaatttacactctcaattacattttttgtaaatatttgcaatttttta
tggcttaaagttagataattggtgtaagataagtgcagaattggggattc
ttgaattcccagagaagttgagtcaaaatttgatagatggattgatgcat
gggatgatggatatgatccaagggtgttgctgaagcaactgaaagttgga
attacttgttgcacaattttggtgtttactttctttttttgttcattgct
ttttgactaagtttctagataaataataatcatgattagttctttaattc
tattcacttaacatactttagctagaagccaccattactacttttggact
tcctaaatgtcattcgtattcatgtccaaatacatgtgttattgacaaaa
atagccatcattacgaacaattttggtgacctttaaaatcattggcaatc
atggacttgaattgtttaaatgtagatgttattacgagttcggactacca
atctaaagtaaaagaaaccgcgagatgggtggattcgaagggaagggaac
cggagagcgatgatgatgcgagggtttctttattgactgaagcatggggt
gctttactagctgacagggaacctgaagaaagcgagttttcgaaaagatt
tggactcaataaatcaagtttaccgaatactcctcatttggagaactgta
aattaagtgcacaagtgaataagcatctcgacgcccgttcaggagccggg
ggatttcctccatggacaacttggaagggttcattgaacatgtatcctgc
aactgaaactgataagaatttaagaagctttaaggatcaacctgtatctg
atggtgcttatcctccatgggtatgttacttagctacataatccctggac
acatgcagatgtgatcatacattatttgtttgtttcgcgtttattgacat
gttaataatatgtattttcgcttctaatttgtttctggaaattgggattg
ctttattccagattgtgggatcagatgaagaaaactatcctcttaccagg
aaagtgcaacgtgacatttggatacatcagcatccggtaaactgccatga
tcctaacataaaatttcttgtggctgactgggaaaaattacctggatttg
gcatcggggctcagtttgccggtatggccgggcttcttgctattgcaatt
aatgagaaaagggtgcttgttactggatacttcaatcgtgctgaccatga
tggttgtaaaggtatcaactgtaacaacttattgctcgtgtaaaattctc
tgggaactggaagaactgtcttaacaataacagcaatgctttactttgct
ttgtggattatagcatcgcgtggtagttggtcttgctacttcttcctaga
gacatcccaggaatgccgagaccgtgcatttgagcttattaccaacaagg
aggcatgggaaaagggaactataaaaggaaaagatagttataaatcaaag
gaaatatggacagcgaaggttccgaggtataattcaaggcatttgcaatt
tgcttgtaagaattttgtactaacttgaactaagaaaaaattactgtatc
tttggtcaatgatttcactattcgatgcagggaatggggtgatccttgga
gttatttgcagcctacaacagatataaatggaagtttaattgctgttcac
cataaaatggatcgaaggtggtggagagcacaggtacgacttaagattat
ttgaatgtttagctatttcatctgttgatttccattgaacatgaagtttt
cgaagttactggtttgagatagtttataaatatattatagactgacacat
gccttatttcgtatgggaataacatgtttattctttcacttaacaggctg
ttcgatatctaatgcgatttcaaacagagtacacttgtggtttattgaat
gttgctcgccatgctgcatttgggaaagaagctgcaaaaatggttcttgc
aagtcttgacaaagattggccaaaggtatgttcatctaaaccgtggacat
acatccatatccaaccttaccttaagttcaagtaacgtaaatgggaatct
aactagaaagaactgaacctcgagcacaaatttagaagagctattactat
gcatgccaaacttcttgttgttataaactgtctctgtggacagctactca
tttgagctttaattaacaggtgatcacaaaccagccaaagtcagaaattg
aagaatttgtgtggtcaaatcatagaccttgggttcctcggccgttgctg
agtatgcatgtaaggatgggagacaaagcatgtgaaatgaaagtggtcga
atttgaagaatatatggaacttgctcaccgtattcagatgcgttttccac
atctcaagaacgtttggctctccaccgaaatgcaggttagcatcttttaa
gatttttacttgctcatagaaacaaagcaatggacgtgtcgctgttgtgc
atgcatctcatctaaatataacgaatggtataaaactaaatttgtaggaa
gtgattgataaaacgagatcataccctcattggaacttctattacacgaa
cgtgacacgccaagtcgggaatgtatcgatggctacatacgaggcaagcc
ttggaaggaaaaccagcacgaattaccctcttgttaatttcttgatggca
gttgaatcggacttttttatcggggcattgggatcgacatggtgctttct
tatagatggcatgaggaacactggtggaaaagtaatggcagggtatttaa
gcgtcaacaaggataggttctggtagagaaacctggttaactgtaggcat
gtagtattagatcaacaatgtacagctattaattttgttcatgcatgcca
ttttcaaataatattgtgcctctttgtacatatttaaatgaacaaaggga
tctgtaacaacatatctaacacaaaatttagacaaagtgattggataggt
ttcatgtcccagctttaaacgagtatttactttatttctttttcttttct
ttttttaacaaaacagcactaatgcgataacaaatataataatatacttc
taaatgatattagtcaaaagatcaaaagatcaatgtctgtcttgattaaa
ttttctatcgagaccaaaatttctgtaacaatctgcacctcattgcaata
taaatttggaagttaatcatatggtgaataactttgttgtggtccaataa
caactcaagaaataatgaattagatgcaattctaacattctactatttgc
agcaccacttgttagaaaagtttcaactatactttatttccattcaccat
ctttcttagatctgtacaaggtatgatgtttgaaacatcttttaaataca
ttaaaatgttcaggcaaaagaaatattaacattgttgaagggttttagag
ataataaatcgtcgcaaacaagtagaatggaacgaaatatttcaggatta
tctttacttcttttgctttgggggaagtaataccatgcaaaacatctctt
caaaatatacttattcgaataatctttattttatgatgagttgttttata
aaggtgtttcacaaaagtgactattctcaaagaacaataatactaaataa
aatttgttttcaatgactttagttttgaatatagttcttgaatgacaaat
gttctaaataagagttgtcttaaacaataattgttataaactagaccctt
tcttaaataaaaattgttctcagtgacatttattctaaataaaaattgtt
ttgaagagagttattttgaatgtagttttctcgcgcaacacaattatttt
agtactgaattaaattttaaattaatgtaataattaagaaaaagtattta
tcaaaactaaatataattttttttaaattaaaatacttaaatgattttaa
aataaaataataataataaaaagaatcaaatcggtgaggtcgcggacccg
atcacataataaaattgtttttcacctctaattcatttgatttaagccta
ttaatcaaggatgtgaattatagttgaatgatatgaaaacattaattttc
ttcagatttaaaaacaacactttccaagcctctctctgcccaactccaga
tttcgaacttggagaattcaaaacaaatccgaaaacctggcctaagcaag
ttacccagttaaaaccattaaaaaacccaattggagtgcaaaataaatgg
gcctaagaattatggggttaaaaaatgtgttgttaatccctaatttgaaa
tttagtttaaaattcaatccttctattttttaaactttaaaaaatttaat
ctaaatattaccatcattgataatttttattaaatttgttaatttagtat
tttattctctaaaaagttaggtgtctacaaaagttaatattcttttaagt
ttaaatgtttgtgacactcacactcaaatttgagtatcaaatattgcttc
atattttaagcttaaaatttatcttaatcttttagtagtttattttagat
gaaacggaaaatgagaaaaaaataagaataagaataaaaataaaatgaat
tatgaagaagtaacaatgagaggaaaaagaatatcaatcacaaaaatgga
acatttgacgaccatggacttagatgcaaagatttaatgtccaataaaaa
ttagaactgaaagaagctaataaagaaaccaggagattttggtccctctc
taatttcacatcacataaaagattcgacagaagaagacaaggcccttgtt
tctttaatcgaagtgattcctcctaccaatcgttcagctagttaattgtc
gagttttgccaattccaaatactanaacgcgagatccaatggtgaattca
gaaattttacattatgggttaaattaaaagaaattaaaatattaaaaaaa
tcatataaattaatgcaaaatactaatattcgataaatcaatttttgata
taattaattgtagaattaatataaatttattaaaaataatttaaaaatag
atgaaataatttcaatagcttgtaaattctcacaccattatcatgaatat
ttttcatatttaaaactattaattacctctatcgtcaagttattaacttt
taaaaaacctgtttagggaaataaaaaaaggtaaaaaaaaagttaatttt
aaaaaaaaattaaaatttaaaatttactttttgaaaaaaatatttcacat
aactatcttttcacaaaaaaaattaaaccacttggcccacctccccaaaa
aaaaaagcaggtacatttgaaaaatttaacacaaaacccctcccaattgg
tcacccagtaagggtaacaccgctctttatttctccccaactccccgacg
ctgtcccacaccactatctcggcccgaccactccaacctccctctccgcc
atctaccaacccaactatcatgtctctcctctccccaacgactctataca
atcnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnggatgtgattgagaagagatgatgtgtcactggaggtgcgagcagtg
gggaagaggtggagtcagcgtgttaagagactgcccaggagtagtgtagc
gtggagaagtggacgggggctggagcgacgacgtataggtgtgaggatgc
gtcgcgcgtcgaggagtggattgagtgggtagatagcggtagatggctgg
agaatagtgattagatggtgggggcggggatggtggggtcctgatttggg
ggtgagggtcagactggtgagtagggggagtgagatgactaagaggggtc
gattgatgtcgtgacagaggacggtgtaggtgagtgacgtgggggggcgt
atgaaggatggtgagagggagaggatcggggatattgggtgaattgtcaa
tggtgtgaggaggcggtcgatagataacggggtgcgggagtgagatgagt
agtcgagtaggatcggatgggagtgtatagatagtggctaggggaggggt
tgagcgagagggtagtgttgccgagagtgaggtgtgggagcgggtgcggg
tgcggaagatgcggagagagtgagaggagatgtgtggtggggggagagcg
ctatgacgtaactaggctaggaggttgtgggaaagtggtcgtggggtgtc
gggcgggtggtggcggggggcgtggcaggtggggagttggggaatgatga
taggttggtgggtgagtgggacgggaagcggactgagcgcgaggggggtg
atagtagaggggacgtagaagggaggggtgaccggtgtcgaggctggagg
atgggagagtcgctatggattgtggggagggaagggagagggcgtgaggg
agtggttggtggaattgcatacgcgagtagaggaggcggaagaggagcgg
cgacggttaatatgtgatgatgggggggtttgatactggaaggactgtac
tgtgcatgatcagagggtgtattgggatgcgggggtgtgttccgggcccg
agtgatgaggggaaagttctcccaattcccacccagtatatagttggggg
gaagagcgtccccgctatagtacatgcgccatgccgatgtcgatgctgaa
ccccatgtcaggacagaggttgacgtatgcattgccatcgatgacgatac
caatgcaggcgcccatgcagtagtcaataacgatgtcgatatctggtacc
tttccgatgtacccgggattaggggtaccttatagttacacgcctatatt
gacccaaacatcatgcgcatcactgttttatcgaggcggcttatcattgc
aactactaaacacgagagcagcggatacacgattgcaggcaaggacgatg
cagcaatcaactacgaagaaaatgatgacgctggtgaactcgaagaaatg
attgcctagggggcagtgctaagtacatatttagacgacaatggcaatga
tgaggaagtctacaagcccgcacctccggatgtacctctagttgtacact
taattccatacagaaatcctctacgcgaccattgtccaccaccttgtgac
acacattctccccaatgacacaattgagtgtattttttgttatcaatatt
gtgatgtaaatataaatatatcataaatataaaaaaaactgaggttattc
attcaaacaatacattttattattattatctatcatgagttatgcgtaag
ttaacaataaataacaaattgaaccaaaaggaatatgcgaaacactctaa
caaatataaaatttggtagaaagtattgttattaacgctgaggccccaac
atatccctatacaaaaagcatgttgtcttcatatgccctaggtttctaca
atacctacataatttctgttgacagtctctctcttgaatatccatgttgt
tccttatccgggtagaatttaggcgacctttcagaatgagatacaagtca
ttgttatacaccaactccaactgtgcgttatacactaatggttacatact
cttatcttggatagatgggaattcaagactccacgcactgtgaatgcgtt
atagtcggtaaacattattaatataaggtgcatactcaatccatatgttc
acatatgcggtaattacatatgagcatagaaatcgaagtgcttggaacct
tccacaatcgcaggtcttttccattaggttcacatgatatgatgcacctg
acatttcctggtcaggcctagtgcgctacataactcaaaaattgaggttt
cgacataagtggcacagtacatacatggtgttcgctcctgttgtactttg
tcaaatctattttatcacgtcattgtataatgtaccacagcccgctatct
gtttaacatacgtcgtccttctctaagaaataagacgaccagttgaaagt
atgtctctttgataactgatgttatcgacaaatgacgcgtccctttcagt
atgaaattgatacactcggccaagtttgacgtcatgtgctcatataggaa
gaatttttttattactatcatgagaaacagcaaggagacattgttgacac
cttccatatagctaggtgccatcaatctgaaccataggcttatagtgctg
aaatacctctttacattgctcaaaggtccaaaagaactggtgaaatactc
tttttctaaggataaactgatcgtcgtagtatattgggctcgttttgaga
tcagttacggaacctggtacgtaccaatctaatgtttaacaccattgcta
taaatagttatacgaaccctcccacccgtgatgtaacttcttcatagcct
tctgttttgtaactcatactttgtaatacattagagtgtaatagtactag
ctatatatgttcacaattagcactggtatttgaatctagggactggcctt
cacaattggtagaataatgtcagcaatcatatccgagtctagcctcggat
ggtcctgacttgcacctgtcgcaacacatatatggggaccgaaatacttc
tttatcgtccacatcctggttttcttccggtaagacgccatgatttttca
cttacacctcttatccttcattgcgcatttttctttaatttttttagaac
gggacttcatgatgtagtagttcacgctgttcttgaagctataccacttc
agtgcaacaaggaaagcatctttattaggtttcctttccaacttccagta
ctcgtcaatcataatatgtgcttgcatgatcaggttttctatgtggatgc
tgtaaaaactctataccaccatcgaccgataggccatttgtcatgtggga
cggaatttcatagccctgaattacgcatttggatctgagaattgtccgag
atatcatcgtctataggggtgtgcataattcgggtaaaaccgaaaaaatt
cggttaaccgaccgaattcggttaatcggtaggttaaccgaattttttcg
gtcggggtcggttaatttttttatgatttttcggttaacggttaattcgg
ttcgaaaccggtcggttaaccgaaaattttcggttaaccgaaaaaattaa
taaataaaattatccaacccaacccaaactcaattacccaacccaataaa
actaaaactaaagtttacccaattacccaatccaataaaactaaaactaa
aagacaacccaatttactaaagtctaaaacccaatttactttaataattt
ataaattttttaaattttaaaaataaaaaataaaaaaattccggtatttt
tcggtaattcggttaattcggttaattcgggtaattcgggtaattcgggt
aattcgggtaatttttaaccaaaaataaaaaatacataattttcggttaa
ttcggttaaccgaccttattaactgaaaaaatttcggttcggttaaattt
ttttaaaaaaaaatcggttcggttaacggttaaaatttttggaaggtcgg
ttaattcggttatagtaatttcgggtcggttaaccggtcggttaaccgaa
tgaacacccctaatcgtctaactcgtaaagttctagctccgttgtaactg
gatctggtttagaacatagtgccacttctgaaccttctgaaccgcgctgt
tgaattggcacaggttctaactcctcccccttgtttgcatccataactcc
ttcttcttcacgcgcatctccttcctcgtcatttccttcattgtcacctt
caagcatggcgtttgacgtaacctcgttggctcccgttgaaagaagtagg
tcatcgattcttctataacccatgtgccaaccaaaatattcaatgggtta
atgcccgatgtatgttgatgatcccccggtataactactttagccccata
acattgatctagtgccaaagttaaaatcgaacgcactgattgaatgtcga
gcccaaagtgtctaaatttaggttatgctgataccctaactggtattgac
ccccaaagtttatatcgatatcggagaccaatgtctctacccataaatgt
tttgagaacatcgtagtagccgctttgtaacaggccaaaaaacccaccgt
acaatcgtgtagtaagactttctaattcaacttcgatacccatattcgtc
gtgacagtaatcaaagatgggcctaatccatcagtatcagtgaacttgac
gtataactcaataacaatatttatgcttaagatgtgtaatgatatagttg
tctcaagatgtgtcttgctaatcacatcgaataactcatacttatagggt
caacagaagaattaaatctgcattgaaaccttgtaattctttcctagttg
atccaccaactttcttcctgatttggttccatcgctcatacattggagta
gtactattgaatgcaaattccacggactttgctcctacaaacaccaacct
gacctctgtattatagatttgactgtcatagtatataacgaatttcactc
gttgactcatttcaatatcggtcacgaattggatgaacaaaggcaaaaaa
ataagtagagagttttccaaatgagtacacacaactcttacagcattagg
ttcttctatttgataataacttgatgcgtgtctattttattaaaattacg
ccccttttataagaggattatgtacagagaaagagaatatgtgttttgaa
tttcgtttacgagtacacacatttcttgcatattgtatggtgtaaataat
tttcaaaacgtgttcagaactcatataatttcatcacgcatgtgctcccg
agagattctactctgtataatatgctttataggcatttgaaaaggtactt
tcactctcagaagaaaggaaatttgtccgaggaagctcacccagaatggg
agctttcccgcacacatttaatatatcatgccgagatgagattatttcct
ccaaagcctatcctagggaagttggttatggggtgatttttctttctaca
gtaaatggtggaagtcgatgtagaggtctcaatcgatggtcgttatgcgg
taatggatcagagtataaaataggagtcagttgacagtcgctatgaggcc
acaagctcaatcttttcgaatacccaaaaatgatgccctataaataccat
acaaaagattaagggcatattcatatagaaaaacttttggacttcctact
ataatcggtgtaagttttttcttcattttcaggcaatcggtacctttaac
cttcattcttattcaaaggttggcaccgtcgtaaatgcaagaggactctc
aggtggaaagcgacagttgggatgcaataaaggtgatgctcctttcgggg
cgacgatacaactcattaataactacaactgctgtcggaccaacccgagt
ttgacctttactatgccagaacatctgctttccacataagaatccttttg
tgtccacctcagtgtcagccttcggatatgaatgaaaggttaaagatacc
gaatacttggaaatagagaaaaaattaaattgattacattaaaaattcct
agagtttttctatatgattatggcctcaaccttatgtatggtatatatag
tgtattgtttgcgagtatccaaaaaggttgaactcctgaccgtggtaatg
attgtcacctagcaccccggttatactcgaacctataaccgcatcatagt
tgccaagtaggatctccacctagacttcgccccttgaacgtatcaagcat
tgttaccttaaaacccgatttccccatgatgagtttttaaggtgatgatc
ctatcccgccatgacatatgagatgtatgtgtactgaagggcgttatcaa
atcctcgacgcctcaaaaatacctaaaaactttcgtcgtttcagtcaaaa
accctgtacactttcaaaataccctaacccataaaaaccttaaaaaccct
agccctgaaaaaataaaaagccctaaccttggagagagaaagtgaaagtg
cgcccagctgggggcgctttcactttctctcttataaaaacgacctattt
ccctaattaaagtttaaaacggcctaaaggcctaattaaaaaaaatagca
tattctgctaatttaacccatttcaaaacatataaattagtcacttcctt
aaattttttctgctaaatgatgacatggaacattaaatatatgttggaaa
ttattttttatggataagctatgaaaatggtcacctaattatgtcttcta
ttctattttgatcactcaaccattaattattttgatttaatccctaaact
tttgaaattaaatatttagtcactccgagttgatgttggtctttttttta
tttggtttagtaacaaaattagtcctctaatgtttacacattctatcaat
ttgatcctaaaataaataaaaaaattcaacaaatttagccttcaatattt
acaaaatttgacatttttagttctaattctaaaaaatttcaataaatttg
gccctcaacatttacacaatctttcaatttagtcctaactctaaaaatta
aaaaatatatatttttaaaaaaaatcatgtttagccctttataacccatc
ttaccctcttttaagtcacttacaaaagaactcaaaaaagttgagataaa
acacaaaaattaagatctaaaagaaaataaaggcattaaaaatgctatat
gttcgagtagtaatgcaaccaatttatcaaagataggttccaaatcaatt
ggtttggtccagtatgaagcctaaattatagtaaaagaaacaaatgcaag
tgacttgaaagatgatactatttttcttattttaatatcttacatgggtt
agccaatgggttataaagggttaaaaatgatttttttttttttaaataat
ttttaaagttaggactaaattgatagattttgttatattgagggccaaat
ttattgaagtttttagaattaaaactaaaatgataaattttgtaaacatt
gagggctaaatttgttaaaattttcatatttaggatcaaatttatagaat
atttaaacattagagggctaattttattattaaactaataaaaataccca
catcaactgagagtgaataaaatattaaattttgaaaagttcagtgatta
aatgaaaaaattaatacttaagtgactaagttagaatgaaagacataatt
ggatgaccatttttataatttactaataaaaaataatttttagatctaac
tctcaccatttaataggaaaaaattaacgaaaattaatttacacctactt
tttagtagagaaatcaaaatgcaatcccttttaattataactataaccca
tagatgagtcatttaaatttctatcttaaattattataaacattactttt
ttaagaagattattaatttatcattaaattcctttaatggttggcattaa
ttaagcatttcaataatttcattcaattaatctagacatgaataaatcta
tagaaatccaaacatagtaaaaaaatagatcagaatagatatagactaag
aaccgacacaatcatgagatcttaaagtttatttttaaaaaatctattct
taatgaaatatttgtttgtcttctcttttactttttgtttcttttttaat
aacttatttatacaaaaaataaattcttgattacactaaaatttgtaact
ttaaaaaatctggtcctgaggatgtataccgatagtagcagtttaggttt
tattttcatttgtatttagtcagaggatagtagcagttgtaggggttggt
ccccgtttctttaaattttccagggtttcaaaccaaggaaaaaaacaaaa
acagtgtagacggtagtctatagagtagtatgcacaggaattgttagcga
ttctatcgagaagcaatcgcaacattcattgttcatttccattactgtta
ggtttttagagatttaaagaaaaagcaaaatagatccaaagaacttgggc
ctaacaaacaaggcaatagaggaagagatgacaaatttaaacatagctga
tgaggaagaggaacctgttcgtgatcaagaagaagaaaaggaaagcgatg
atgaatttaacttgtgtaattggtaggaaagatcctaacaaatagtgcag
tccacttcccatctatggtgtttgttcttgctaaactatggcatccaatt
gaaggtatttccataacaaaaatcgaagacaaaagaatcctctttcgttt
ttataacaagttggatctaaggaaggtaacggatgacataccatggtttt
tcaatagacacctaattctttttctttgattttctcgaattttttggtac
aaactcccattaatctaccccttggttctatgtcagaaagaatggcaaga
cagttgggtaatttcattagacgcttcttagaatacgatgcatccataat
aacaaaagacgtgaagaagagttaaggtttgcttagatgtacgaagccct
tgaaaaaaagaaagtgcataatatatggaaagaacaaatctacctatgcc
actttccaatatgaaaagctatgttattttgttttttatatggaaggtta
gggcatgaagagagtctttaccctttatcattaactacaaaaatataata
gatgaatcggggtgggatatttctctaaggggcctaccaagacggaatgt
acaatttgagagtagatggttgcgagaagagccaagaaatatggtaaaaa
gtggaagtagtgttgaggagcaaaagggaagagcaatgctggttggtgca
ttggaaacccaatcatccaagatgatgggtaaagaagtaataacaaggcc
caacgatagaggcattcttgagaactaccgaagaggtgccggcggatatg
gtattgacaataatttggagcataaccctttatggaggatggacaaagac
cacgaagaggatccaattggcatcctagaaggaaagaaatgttagagggt
gaatcaactagaggagacactcactataagtatgaaaactaaacatcaat
ttatcggcagccactaacaagtaggccgatcggtcccaatgaaaaccctc
cgccgtttggggcaaccacagacaataagatgtctcaaaaattaactgag
acagtaccaaccccagattttgttcattatagaaacaaaatttagttaaa
aatagatgaaacaaatacagaaaaagtgtggatatgtagataggattgat
gagggtgcgggtggatctagaggacgtctctttttaggatggaaagaaaa
cttatctatagatattaaaagtttttctagctcgtatatttatgtaaagg
tcaaagaagagagcgaagaggtcgaatggagatttataggtttttatcga
tccccgatagagcatctaatgagggattcatggaataagctatgccgctt
gcatgaggattgtcaactccattggctagtcatgagagatttcagttaaa
caatgtactcatttgagaaaaaaaggggaaggttgtgagaagaaagacaa
atggtaacttctagggtcttggaagattgtgaattaagtgaccttggctt
ttcaaggcaatggtttacgtgggaaagaggacgactagcgaaaaataata
taggagaaagattagatagaggagtggcaaatccagaatggtggagttgt
tttcctagttactatttgcttcatttaacacactgtttctcggaccacta
tccactgctattggatactttggggcatcgaggtggtataacaataagaa
gaaaattccccttctgtttcaacgcagaatggatacttgaagaagatttt
gaggtacaagtgaaaagaatatgggactcaattaatgaagaattcccggg
gaaatttacaagtttgggtaactccttaaaagaatgggtcaagatcaata
aaggcattcgacacaaaacaagaaaagagttaagccaaaagctcactgaa
cttaataatgaagaccccgaagaagagtggctagcattaaatatggaagc
taataaagaagaatttttttgggagcaacgagcaaggaaaaactggctta
gaatgggtgatcataatataactttctttcacaactatacgtcctattgc
aagaaaagaaacacagtaaaagggcttgaagatgaaaatggcagatggat
cgagagagattaagaatttctagctttagcgacaaaatatttcaactatc
ttttctccttaaaatccttacaggattgcaaaaatttatggataaaaatt
caaccttgcattaacgaggaattatcagctagttttaaagaaaaagaatt
gtgggaagtgttaaaattaatggctcctctaaagtcttcaggtacggacg
gattctttgctcttttctttcaacaatattggcatattgtaaggaaggat
ttgtctagactctgtttagtaattttgaacaatcaaaaagaatttggcgc
tattaacagtagcaacattgtcctaattcctagagttcaaacaccaaaaa
atatggggcaatttaggccaattaccctttgcaatgtagtttataaaata
atctcaaaatatatagtcaacagatttaaaaaggcccttagctactgcat
tgaagaaacacaaggtgtatttgtaccaggcagacaaattactaaaaaca
tattagtgcaatatgaactattgcattctttgaagaaaaaaaaagatatg
gactaggaaaattttctctaaaactagacatgagcaaagcataaaatagg
gtagaatggacttttgttgaaaatatgacgaaaaagctttgattttatga
caagtgggtttcattgatcatgtgttgcatcaaaagcgtttcatactcag
ttgtgtttaatggagggaaaggatttaagttcaaccccactagaggaata
aggcaaggatatcctttaagcccatatctattcatcatttgcgctgaggg
tttttcaagacttcttaatatcgcaaaaagggaatgaagaatagaacgga
aaaatagggagaggtggtttgtcaataacccacttatttttcgccgatga
taacattttatttgaaaaagcaatagtggaaagagccttagccataaaat
cagttgttaatgattacgtaaaaatatcgggacagttagtgaatttcgaa
aaatcattaatttattccagtaacaacgttaacgaggcggtcaaaatgta
tatatggagtgatttgtggttcgtattgctaacaacctcgataaagatct
tgggttgttgatgatggtgggaaggagaaagagaaacgccttagtaaaaa
tcaagtattttttttttttgacaaaagtgaaaaattaacagtattcgtaa
tttgtcaattgaaggaaaagagaagagatgtttattaaatcagttttacg
agccatcccaatctatgttatgcaatgtttcaaattacaatttcattacg
ccgagagttagagaacatctgtaaattttaaaaacaaataagggtattca
ttggtgtagctgggcgtcattatgcatccccaaggtccaagggggctggg
tttagagacttatcgttttttaataatgccttgttggcaaagcaaggggt
ggaagttaatcaccaatcccacaagtttactcacgcaagtaacgaaatct
aaatgctacccaagaagtgactttttgaatgctgaattaggggcttatcc
ttcgtttacatggagaagcagatggggcgctcgaagtattttggaattag
gcatgggttggaggatcggagatggcaaatcagttaatatatggaacgat
gcatggcttcttggagaaggaaaattacagtttcagaatatagattacaa
gtatactttagttgcagatctaattaactatgaatttgttacctggaatg
aagaaaccttaagagggcttttccctgaagaacaagcaaagataattggc
tccatccccttagggaacaccttacaaccagatacaaaggtttggcgagg
tgacaggtagagggaatacatgacaaaaaatggttacagacgatgtgtca
tagaggaattaaacctgctgggaaatgaactgacaacatatctggaacta
actagaagttattatacaaaaacttggagcctaaagattcccagcaaggt
acgactcaatctatggagaataattacaagtaatttcttgcctacattaa
gtaacttaaaagcccgtaggctgagatatgttgccctatgcccgctatgt
ggagaacaagatgagtcagttagccatatttttcgatattgcaacattac
ctctagcaaatgacagtgacattggtgcccatacatgaaaatcaagaatg
gaaacaatggttagctgaaacgttcaatatcaataatgcatataaatgta
catgcctagcagtatcgctattggcaatatggcataacaggaacaaatac
taccacaaaggtattcgacaaagaatatgcgagatagtggcctttatcaa
agcatatataactcaaattgacatgctataggaagcactgaaatgcaaac
atgttacagagaaaacccagtgggaacccccaacagaaagtcaagtaaaa
gtcaactttgataccgcgtttcaacaacaaagcaacaaaatagtttcgaa
aataatcatcagaaatcatatggggctagttatgggttcatgtacttact
cgatcaacaacgtttgagatccgacaacctccgaagcgtatgcatgcctt
taaggagttatctttgcagaagaaatggggtttggcaatgtaatcatcga
agaggactcaagaatcgtcataaaaaagctacaaaatccaggaaacgaca
gatcaattattaggggttttataaacgaaataaaagaaaagtcaagaaat
ttctggaatattgtgttccattacgtaccgcgagaagccaacggagcagc
gcatgcgatggctgcctgcggaagaagaagcgactcttcgactttctggg
tggaagaagctccattagaggttgaacccatactactaagggatccacgg
acaactgcttaccgcaaaaatatccgtggttcgccgtgggttcgactccg
gacaacagaacgggctcccatctgggaggaaacaaacccaccccagcacc
ccgcctcactttacccgttccctgtaaaacccccaatccctcccccaacc
aaaccaatcacaccgcccagacactcccctcgacgctcgcccgttcatgt
taactctcctttccccgacatcatctctccccctcccaaaaacgctaaca
gttccatccccccttattcaactcctactccacccgcccccctcctcttc
tctcccccccttattactccctccctccccactcccgctaccctcccgcc
agtccctctatccgcatccccgccctcccacttgccgacccccatgccac
cacccctcgccaagcatctccctcccctccaccccatcacatccaaaann
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnct
cgtcctgtttagcttttaacctcacgattttttttagtttcaaatttgtc
cttaacttgttttgctttatttatttattacttttctgttttattattgt
ttattttaaatctctttatatattatttatttcaatttttttatttaact
ttctttcatgtatattatttatgttaagcttatatattattgactttaaa
tgtttgtttatattaattagttaaaactattttttatatattttttattt
ttatgtattttttattttaaaaattgttttatgattatttattttaagat
cttgtattttattttattttaaaaattgtcccacatttttatatattaac
cgattcattaattattatcttttatgcatattacatagttttttttaaaa
aaaattgtaattcaaaatttgttgttttctatcgatttattatttattta
tggttattattcattttaaacacatgttatttatcttatattatcatgta
cgtgcatatattattctttttttaaatttatctcattattcattttttaa
aattactttgctatttactcaatttctttcttcttctttttaaaaaaaaa
atgttttatccattgtaaacttcactatttttttgaaattgttttttaat
tattatttttaatatatcattaattttacatactttattagatatactgg
atttcttttgtataaagttctattttgttccttcgcttttattttatgta
tgtatattctcttgagtcgttatttacttttttattgaagtttccatatt
ttatcattctttttatgtaaaccttgacattgttttagtgctatttgaga
tattagttttgttgttattatatgttcccttaatcatttatactagcatc
gaaagtcagcacgttgtgcaatgtgaattatcatttagcatttgtatttt
atattctattgttgtaatggttttgttaacgaatcgtcatcttaaataaa
tgcatttcactttattattgcattttattcaaggatttttgaaatcaggg
caatgtttcgtgtttgaaaattcgagaaatcgtgccctaacgtgttgggt
ttcgattttttgtttggccaaataacggaatacccttttaagatttcgtt
gtgtgttttgaaaaccataaggtgatctcagtttttggacgcttaaaata
tcgtgtcttaacgtgtttgatgtggtatttcatttatttggaacgagtga
atcttaaaatccaattcgagttgttcacacatttttaaaggaatcatatt
ttaacatttttttcttcaaattttcaacgataggacattaaataatcaat
tggtaccaattttgggtattacgaggtgctagcccttcctcgtgcgtaat
cgactcccgaactcattttctcaattttcatagaccaaaaattattgttt
taataaatcaaatattttattaaaatgatcaatctcaaggtgatccgatt
gcacctcaaaaaaagatcggtggcgactccgaacttttgttttaaaaagt
cgattcttattttttaaacttaaaaatgatatccgagcttctgggttgtt
catctcaatcacagtaatggcgtctttgaattatgaaattccgctgttgg
atcgcaacaccagatttgcattgtggcagattaagatgcaagcagttctt
gcgcagatggatctggaggatgccctgctagggatagataagatgccttc
gacactaacagatgaagagaagaagtgtaaagatcgaaaggcgttaacac
aattacatctgcatttgtccaacgaaaatttgcaggatgtgatgaaagag
aagactgccgctgtattatggaagaggctaaaacaaatatgtatgtcgaa
aactctaacaagcaagttgcatatgaaacagcatctttatgctcatcgtt
tggaggatggtgcgtctgtacatgaacacttaacagtgtttaaagaaatt
ctctcaaacttggaggccatggaggttcagtatataagaaagatttaggg
ttgattctactttgttcgttgccccccgtcttattcaacttttagagaca
cgattttatatagccgcgagtctctcacagttgatgaggtttatgattct
ttaacctcgtatgataagatgaagcatcttgtggttaaacccgactctca
gggagagggtctcattattcgtgggagacaagatcggaatactgatgatg
atcgtggtaggacacaggaacggaatcttcgtggtaaatctaagggtaga
tcaaagtatttaaactgaggtaaaacttgtaacttctgcaaaaagaaaag
gcacattaaatctgagtgctataagctacaaaataagattaaaagggagg
ctgcgaatcaaaaggaaaaataactagaaaattttggtgaagctgatgtt
gtagaagactacagcaatggtgaacttctagtcgcttctgtcaatgattc
taaagtaagcgaggagtggatacttgattcaggctgcaccttccacatga
gtcccaattgggattggtttacaacttacgaaacagtgtctgaaggtgtt
attttaatgggaaataatgctttttgtaaaattgcaggtattggaacaat
taaagttaagatgtttgatggagttgtcagaacacttagtgacgtacggc
atgttccaaaattgaaaacaaatttaatttcgttgcatactcttgattca
aaagggtatagatacacagctgaaagtggggttttaaagatttccacagg
gtcatttgttgtgataaaagggcagagaaagattgccaagttacatgttt
tgtagggttctactgttactggtgatgcagctgtcgtttcctcttccttg
tcagatgatgatattactaaactttggcatatgcgcctagggcatatgag
tgagaatggcatggcagaattgagcaaaagaggacatcttgatgggcaag
gaatttgcaaactgaatttctgtgagcactgtgtttttgggaagcaaaaa
gagagttcgattcactagaggaatccataacacgaaaggaacgatggagt
atattcattctgatctatgggggccatccagaatgccttcgagaggtgga
tctaattatatgctaacctttattgatgatttttccagaaaagtttgggc
attcttcctgaagtagaaaagcgatgtgttttccgcatttaagtcttgga
aaattatgattgaaaaacagacgggaaaacggataaaatacctccgtaca
gacaatggcttaaagttctgttctgatgagtttaatagattgtgcaagtc
agaagggatcatgagacacttgatagtttttcatactctacagcaaaacg
gcgttgcagaacgaatgaacagaatgatcatggagaaggttcgatatatg
ttgtcaaatgccaacttaccgaagtcattttggggagaaacagcctctac
tgcatattttttgatcaaccgatctccatccgttgccattgagaaaaaac
tccacaagatgtatagtctggtaatcctgctaattattctgatttaaaga
tttttgggtgtcctgcatatgctcatgttgataatggaaaattggaaccg
agatccattaaatgcgtttttcttggttataaagctggtgtaaaagggta
taagttatggtgtcctgaaaatagaaaagttgtgattagcagagatgcta
tttttgatgaaactgctatgctacctaacttatctcttaaagactctttc
aataatgaaaatcaaaagcaggtgaagcatcagattaatacagagtcaac
tcctcaagccataacaaaaattgagaatagagttgcttcttcaccacaat
gctctatcgtcaaaaatagaattagaagagaaattaaacctccaaagaag
tatgtcgaggctgatctagttgcttatgctttaaatgtggctgaagatat
agatacgaatcaagagccatcaaattattctgaggcggttagctgtgaaa
actcagaaaagtggatgtttgctatgcaagaagagatggaatcactccac
aaaaacaaaacatgggaccttgtgaaacttcctaaaggtaaaaagactat
tcgttgtaaatgggtgtttaagaagaaataagggacttcaggagttgaaa
aacccagatataaagcaaggcttgttgcaaagggttacagtcaaattcca
agagtggacttcacagatgtgttctctccagttgttaagcatagttcaat
tcgagctttgcttggaattgtggccatgcatgatttggagcttgagcagt
tagatgtaaaaactgtatttctgcatggagaacttgaggaggatatttac
atgcaacaaccagagggttttatagtttcagaaaaagaagactatgtttg
cttgctgagaaagtccctttacgatttgaaacagtcaccaagacagtggt
acaagaggtttgattcctttatgacttctcatgatttcaaaagaagtagt
ttagatagttgtgtttactttaagaaaaatagtgatggttcttttgtgta
tctacttatttatgttgatgacatgttgatagcagtaaaagataaaggag
atataagaaaggtcaaagctcaattaagtgaagaatttgagatgaaagat
ttaggaccagcaaagaagatacttgggatggagattctcagagatagaaa
agcaagtaaattgtatctaagtcagaaggggtacattgagaaagttcttt
gcaggttcaatatgcagagtgctaagcctgttagtactcctttagcagcc
cattccagactttcatcggctttgtctccacaatcagatgatgaaattga
gtacatgtcacatgtttcacattctagtgcagtgggatctctcatgtatg
ctatggtttgttcacgtccagatttatcatatgcagtcagtgcagttagc
agatacatggcaaatcctggtaaagaacattggaaagcagttcagtggat
tttaagatacttacgaggcactactgatgtttgcttacagtttggaagaa
ctaaagatggagtcatagggtatgttgatgctaattttgttggagacctt
ggtagaagaagatctctcacaggttacgtctttacaatcgaaggttgtgc
aattagttggaaagccactttgcaaactacagtcgctttgtttaccactg
aagctgagtacatggcgattactgaggcttgtaaagaagctatttggttg
aagggactatttagtgaactcaatgaagaccttcaaatcagtacaatatt
ttgtgacagtcagagtgccatcttccttacaaaagatcaaatgtttcatg
agaaaacaaaatatattgatgttcggtatcattttgttcgtgatattatt
gtttgtggtgatattgttgtgagcaaaattagtactcatgaaaatcctgc
agatatgatgactaagtcacttcttataaccaattttgagcgttgcttag
acttggttggtgttcattgttgaagttaaacccttaaggggttttatgga
agaggtggagaacttgttcattaaaagttcgcgatgaagaacttgttcat
tgagaatttgtgtcaaggtggagattgttagaattaagtgacccgaattc
ttatttaataaaatacgatggaaaataaaataaaagtaaaatccatatag
aactagacttcttttattttattttagaataaggtttttaaaccttatta
aactccatctattttatattgattaggataatgtgtttcaatcctactag
aatatggctttacaagcctgtaaatagacatagtctattcctcttgtatt
gaattcgaatttttcgacatagtgaattttcttctcctctatccatggtt
ttttcccaaaagggtttccatgtaaaatttgtgtgttctttatttttttt
cacaaaatatgtattgaatcataaaataaaattgaacattggtaccctct
tagttgttctggttgtgtcagatatagttggcatgccataggattggatt
gtgtatgagattatgcgattatgtgccagaatgagcttcgtgcgctaaga
tgcactatatgtgccaattttccttactttagtttattcgatgatgcact
tcgatgccagtttggtgtattggttgaacgatcgtgtatatgtctgagtc
aaagttaggttaatgggggttataaattgtaagttttataaatgatactg
aaatgaaattatatggtgctacggaatcaaatatgtacatgtgtgaattg
tgatagagaaagcatataacctatcatgcaaatcaatggaaaacgagtct
taggggtcgaaacgaatgtgaatgagtctattgactccatatagggattt
gaatggtaagttaaaagggtaaacaaatgttgattgaatatggaattaga
taacataatgttaaaggtatataaatgtatgtttgattcatgattggtaa
tgaatataaatgtagtataaatattggtacttgacaagtagtatgtattg
atcaattcttttatatatatgaaatggattgaattgatatttttcatata
tgtattcagctatgtaatggtatgaagtagctgggcttgattgaatataa
atttgataagtaatgtatttgtattttgtgatcaattgctattgtttaag
atatgttatcttgaatcatgaaagtaccactgaactttatcacttaacgg
tatgatttgtttattccgtgcataggtacaggtaatccttgaagcctcga
gaggtgaagtcagcatgactcaatatagttgtaaagttcctttcattttg
tcaaaaatcatgtacatagggttatcttgtttcaagttggacatggttca
ttttgagtaatgatgtagtacatgaatgaaatcgttactagttatgcatg
aaaatggtgttgatgtttccgaaattgtatactaaacatgttgtatatat
gttgaatgagcaattgaggccttgaggtcaagcattgttgccatatgcta
gtttaaaaatgtatgaaattgggaacttagtaaactgttgaggaagttgc
gacaacacctgtaacaccccaaaatgggcccagttgttatggttgaattc
aaaaagttacattggccaccagaatggccaagagaaacttttcttgattt
caaacgttctttttttaaaccatttgtgtagttcattcaaaactagtaaa
atcaaatgttcaactttattttcaatctcatttcaaaaaccatttgtcca
cgaaaatggccgaaataaactttcgaaatttttaaaaaatattttaaaac
tattggcttatcaattcaaaaaaaatgaaataaaacgtttattttaaatt
cataaaaaccgtgcaaattttaggaatcgaaataagtaatatctcaattg
tatacattcaatcatttattcaaaactatttcagattttcaatcatactt
ctaaatcatttgtctttttattcaaaagaggagaacttggttattcgtca
ttatttcggaaataagaacatattaactttataaatcaaatgtctttaga
aaactcatttgtaaacattaataattttgaaaactaagtttaattttatt
aaaaactcatttttcagaaatgtggaaaaatgtgttattaacagattcta
ttttaaaaacctagtttcaagcaaaatcttatcaaatactaatttatgca
attttaaaacttaatgtccagcaagcaatttatgcaaatcagaatgaaaa
attccccaaaataaagtctcatgccatagtccatacttaaacttattaca
aagcccaaaatatcaacatatcaaaataaaatttaattactttaaattaa
aaaaacttcggagaaactcctccaaatgccatcattgaatcctaacctcg
gggttatctgtaaaatcaaaaaactaaagaggggtgaggtataaaactca
gtgtgagattaacataaacacaatcacatacatataaacatatacattat
acaatcataataatcatatcaattttatataacttaatatttcaaactta
tgctatgcatgatcatgtcaatgcatattttgtaaaatgatgcagatttt
atgaaaacagtcctacccatctccgttacacaccaaaattaagtttccca
gaacttgtccatcaacacaccaaattgtgaacagtgtcaccaaaatcata
gataaactgctaataatctatattgtggacaagccacaaaaatcatagat
atactgctacataatcaaaattgtgaacagtgtcatattaatgcagataa
actgccacatgcttccaccttttacatatcccaccctatgtatgtgatgt
ggccaaaatcattttttcacttaaaaatcttttttcactttggcatggag
acatgctcattatatcacttttcacttaaaatcacataggcatacttaac
atgcaaatcatataagtacacatggtacaaaaagttcacattttataaat
catgcgaaaatcaaatatgccatagatcacataacatgagaatgaaattt
tcataattttcatatcattaataatataaaaatgacacatcatacatatc
accaaaatcaatggtttcaaatcacttacttgacatagtccataacgatg
ggttttatcttcttaatggatacataatgtatcctaatcaaacataactt
aaataaaaattttaacaatataaaacataggtttatttttgtttaatatt
aaaactcacacttgatctaagcaactccaatgcgaaaaacttcttttaac
gcccacttccaaatttaattagatctatctcagatctaaacacaaaatga
ataatccatcattaaattgtcacttaagttatccttttaaataaaaacat
attaatcttgatttctgataccacacttacgctaatacgattagaatcaa
atatatgattcacttcccaaaagtcaaaggtgttccaagttgttagcaat
tgaccctttacacaagatcagtataagatatgttattgaagaaaaacgat
gtccaacactaatactacattcggatattaataaaaagatgaggaagaag
tgatgatttagtgcccaatatcatcccatacctacgttattccttaacca
aatcttcgttaaatcaatcgatcaagaggaaagaaaggctaaatcgaaga
aacaattgatagcaaaggatctttttaggataaaagcaataaaattccaa
caatgatttatcaaaactaaaaagatagaaattaaggtggaagtggcgag
tttttgagaagagaaaagaaaaaataagaaaattggcggtcatggcggtg
atgaggtggtggtacggagatggtgtggttgactaatgatggtggaaggt
agaatagaagtggagaaaaaaaaggtgcaatggtggctcaaagaagaaga
aaatggaagagaaaggaggaaaaagggaggattaatggaggtatcggtca
agagaggaggagaagacaccaaaatgagagaaaaaagtgaatggtagcta
acttaggtgggatggatggttcaagcttgctaaatgggagaaaaaataag
ctttgggggacaatggtatgaaaagtgaatcaagggggaacatgtggagt
gaagagtggatttatggaggaaagttgactagctaaaggacgaaagaatc
tttctttgcatggcaattaggagtggacagttatggaaactttgaacaaa
gttaaacatgagaatgtggggaattgaacgtaggacctttaggaaattaa
ttaagcacttaaccatttgactattcactagcttgttataattcctacaa
catttattttaaaaacatggtgtaacatttgctaaggtttgaggcaaaat
tgcaccacataaaaaataatgtgaatgaagggatttgaaaataggttatc
aaggacatctccaccactactcaactactatacttgatacttatttattg
tcaaatgagaaaaatattatctaaataaaaatttgattgtaaccactctc
agttcattaaaccaatttctactaacccagattttgggatgtgacaacac
cccttgaatattgcaacatcaacctttctcatcgtgacataccctatttg
aggtctagatgtcgactctgtattattttgaaaacttgacaatttcatct
tcaagttgggaagcttgcatattgtctttaagaccgcgacaccaaaccta
gaagtcgcgaaactagcttgaaagttttgaaaatgttgcagtttagtcat
tattcaatcttggggtagtattaagcttccataagcttgtatatgacctg
aagatgagtataagtcttgttttatgcatgtaatactcatatttaaatgt
ttaatgatgaaatttgaatataattgattgtagttactccaaaaacgaat
gtggcatcccgtagctcaaactcgatgatcaggtcagctatacggtgtta
caaggataacatgtttactagttcttctagttaccaactccatattatta
tcaagtatgaaaacaccatatttataatcacatatcattttcatagcatc
tatgttaggcacaaaaatactatgagagggtgaattagattttaaaaaat
ttacaaacttttctaaatataaaagaaattgaggaaaagcttagacaatt
tgatttatagtcatttggccctaaatacatacctctactaccttagtata
ccttaattagggattttcctaaaccattctattaagtaaatacctttcca
ggataaggtgtaatatttacaatccttaacttttaaaggcttagttaaaa
cctcatccccttagtttttatggaaaaattagaaacctttagtttgtata
aaggcacaactagcaacctccatttttttaaagattttctacccaaaaac
cttaactacactctttaatttcaaagagaaaaggaccaaaccaaagatca
acctctaaaagacaagtgtttgcaaagttaagctcactaatataatgaaa
agaggatacaaaatatattacaataaacatgcaaaaatggtatctaacga
gtgtaccaaatactagtaagatatcaatgagagaaatccctaaaatgaat
gttatataaactagaaatttatcaaaaactaaactaactcaggggattat
ctcaaatcacttagaggaatgttattacaaatcctttaaaggagcatttt
caagcccttgaggggatctttcagtcaaatcttttcaagaattttttata
taaactagaacttcataagaaactaaactaacttgggaaatgacctcatc
aaaccactcttttttgtgacaaataaggcaaagtaaggctaccaaagtat
tgactttccaaccaacattaatgttcgaagcatagttgcattcttaggtt
tttaactagttaagttatagttgctcttagacatggtaaaacattattat
acaatgtattacaagactaaagaacaaagggtaaatctcatgaaaggaga
ctaacctacaaaaggaaaagggataggtgtcacaaagagtaatcttaaca
aatcttgatcaagacctgaaataacctctaacgaggtaatgaaaagacaa
taatattctgtaaaatatgggacaacctctaccaataaaggaggctaaac
ttggccaattagtaggatgaaacagttacaccttaagcaccaccatgcat
cactatacaattgaaacacctgcaacaactcatataataggaaaatggat
atctacttcagggtaagaagccaaccttactttcactccaccatttctat
ttaatttctccttttctgacttaagcatcaaagagtgtctgggagcacaa
gctttaatacctaatattgaccttttttgttttacaagtcatcctcttct
cagcccaagtttctctcactcaatatttaataaacttgttaataatatga
ataattttaaagcggatatttttatttaacaaataataattttgtctcag
ttagatttaaagataattgattaaattttatataaagtgtttgttttagg
tgtgtgtttttaagtttaatacctctactataatttaattatttacaatc
atattcctcaaaatgtatatttgaggttaatcttttttcattatttttgt
caaataatttgacatcctgtgaatttttttaaagttagacaaatattttc
catatttaaaaaataaataaatgtataatagttgtccaattgtaaaaaaa
atgttaatgtgtatttttttaaagcgaaattcattaattcattcaatgaa
ttagaccatacaattttaggggaaggggaataacaaacacccattgtacg
cgctgaaagacaagctccatcaacacaacaaaagcttcagctttagaatc
aataaaacattatggcacgttgacaattgactctatcacaactcaagtac
aacatatcaagagtgattgtaagcacttaatacaataaggaaatcagccc
cagatggtccaaaatgacgggcataaatcagcaaaagaaccaagcatcca
ccaaactagagaggatggcgacaaaaccaaccctaaaatcacttgcaaaa
gcaagactatatgcataagtaagactaaaaagcatactacaagagtagac
aaaaatttttaaaagtgaaaacttattaaacaatgaaaaagaacacataa
aacttaaaacaacaagagtccaaactgactcatgaaatcatttattattc
tgaaactctgtaaaaagaaacaggttaagaagtcaataaagagctgccca
ctttctaaaagaaactttctgtggttgattgtgtttcaacgatgataggc
attgtcatttgtctatcacaacttgtgaaggcaacgaagatacccacaaa
atatatatgcaaactggaaagaaagaagacccatagagtgaatgtgaaga
aaaaagaaaaaagaaaaagagggttgatgtgcaagagaaaaaggcgggca
atagctagcttggaggctaacatcgccgctaggaaaaaacaaaaagataa
atgttaatgtgtatttatttcaacggaattcatgaaaaaatatttgtctt
acggctaaaaatgcaaatttcaaaaagtaaaggaattagaaattaataat
ttgtaataaaggattaaatctataaaaaaatacatagtacaaggaccttt
tgtaaaattttaccagaatatttttattacagacctagttttattcgcat
agtctgtcggcttgcgcaacaaagctgatagttgaagaggttccttcccc
acatggccacgttgatccacttaactgtttaattgggttaaaataggttc
aattttctctattttttatttagaatttcttgattttttttatcagatga
atttcttgcttataattacaaaatacattttagttggtcatgaaactttc
tattgtattgtgttatttatttaatttttatttcaaaatttcagtaaatt
taacagaatttttaatgatattaataattatatcttaaatttgaaaagaa
gattaaaattttaaaatgaaaatagaagacgaaatatgaagaatacaggg
acttaacgtagattttaaccttttaatttttcacaagaaaaatcagtaga
ctctttttctttcaagtctaagggcccctttggtttcaattttaccgcca
gtgaggtgcgtttataataaaaatttgctaccaaactcactgcagcgttg
tttgtttggactatcagtgcagtgagatttctttcctaccacactggtca
gctgattttcagctggaggaaatcagcagcagtggatgaatttcttaagc
tgttggcactgtagcagacaaaaacacccttacttttatttattatttac
catttatccttgaaaattacattaatatcttcccgaatctgcagaaaacc
ctgctcttcaactcctgctcttcaattgacactcacagcagactcaaaga
cactcacagcagactcaaagaagctctatttttcgactcatatcttgttc
tcaactttgctctggtaagtcaaaactcttctttttctactctatatatg
tgtttgaattgtatcaaagtagtttctgtttttccttctcatcttgttct
catcttcttcttagctaagaaaataacaacaaataaatatgtcctcacat
ggaggacaaaatcttaaagcagttaagtaattagtagaaatgaaaaagaa
tttttgttgttcatacacaaatccatatgttctttctccattattttttt
acctctacttgccgttaaagagattgaacataattgatgatttcatcaag
cataccagctttgcctgtgattttgttacatcctggtataaatcttgcag
atacttcattctttcactgattttctcctttccaacctatataaatcaac
ataattaaaacattattatctaatgaaagagacctgataaaataagaaaa
caaatcagtaataataccatccatattaccgagtaacatgccaacaacaa
aaaaaacatgcaaattcatactcactttctcagctaaactgtggttggtt
tggctcgaaaacaccccacaacttaactcactgaaatagctttgctgttg
ttgttgttgctgaaactgttcctcttgccatttcaagcaagccctttgcc
tctcgagcactacttacagtaagaagaatggatgctgattcagttgctga
catgttgaatgcaaaataaaatggcttcagaccaaacttctttcagctag
tcaaaaatactcaataagaacttagttttagattactttttggctttctt
tcataacctgagatcaccaaagaccattgctcatatttcaaaatttaggg
ctattctaggaagctgttaaaagttcaaactgattcaatcaagtaaacaa
ccaaccaagaaataacaaaataatacttcagaagcatgcatgtatagcag
aagtttacaagttaaaaacaaaagtacttaacttagaaacaaaacatacc
gatctaatatatggttgctggaacaaccaaccaacaataggtatcctctg
caaaaacactgccagtgttggccaaaaaccactgccaagtcaatagacta
aaagataatctcattaattccatcttcaacgtccatacctcctcatttgc
tgctaaataaaattaaagcaaaagccatgtaatttaaaagtcaaacatgc
caacactaaaactttgactatacaaaattgttattctatatgttgttcga
atatgaaatggaacaagagaagcaatcaaagttctaataatctccctctt
tgacattttgacaagatcaacaacaaataattaacacacaatctgaacaa
atcaacgaaaactagaatatatctccccctaagaaatagaaccatgctcg
accatacacttcccttgtcaatatgattggtcatcacattgtccaccaag
catacacacactttccaaagtaatttcaagaaatatagagcatgacaaat
aatccacacacactttccatttagtatcaacaaaaaccacaaaaagtagt
ataaagagaacacgagataagcaacaaatcaacatctatcgtatctaccg
tttgctacaccagatcgactctggcaaagcataaagcaacaatcattaac
aatcaccatcctcattttgaacatttgctgctacttctcccccttttagg
caaagatgtcagaggagctccccttacagaaattttcaattttcaggaca
aatctttcaatcaaagtctgctactctgttacatccttctctattccatt
tttttttgttgtaacaggattagagacataagtattttcttcattagctg
actcatattcctcatgtacttccattcactaccaaattctactagaaacc
aaataaaagaacttgccaaaacaaatccaaccaccatatcgaaaatcatt
ccacaagcataattaaaacaactataattagcataatctggaccgtgcag
cttacatgtccatacaaaaatggcgatgcaatgtgtattgtggttgacgg
agggttgggagtgtgtatagccgagagtacaataaacccatatgcctaaa
gagcaaaattaatagaagccaagcatttttattaaatcaagggaatgaaa
aattcaaacctaaagagcacaataaacccatatgcctccaataccatgcc
aatgataggccatccgatgacaacgaaaaagaagccaacaccaaacgaaa
ttgttccctgcattcaatagcaataaattataatgagaacaagagatgaa
cacacaattgcgtctgttgatgtgcatatgtgtgagacaaagagagaggg
agaggataaatcaaaccaaatgaaaaaaagcgaagaaagcacaaattaaa
tcaaatgaaaagattcagagattcgttaaccaaatgaaaagaatcaaaga
aagcacaaattaaatcaacaacaagaaggaaaaaaaagagctcactcttt
cggtcgttcatttcaaaggaaaaaactgttgcattcaacacctggattgg
gaagtttcccattcacttcccaggattatcttcactgctttttcctcaat
tttgacccaaatttccccaatcatcttatttctaagaaacttacaaatgc
aataaattataatgaaaacaagagatgagcacacaattgcgtctgttgat
gtgcatatgtgtgagacaaagagagagggagaggataaatcaaaccaaat
gaaaaaaagcgaagaaagcacaaattaaatcaaatgaaaagattcagaga
ttcgttaaccaaatgaaaagaagcaaagaaagcacaaattaaatcaacaa
caagaaggaaaaaaaagagctcactctttcggtcattcatttcaaaggaa
aaaactgttgcattcaacacctggattgggaagtttcccattcacttccc
aggattatcttcactgctttttccttaattttgacccaaatttccccaat
catcttatttctaatcattttatttctaagaaacttacaaatgcaataaa
taattataactacaaccaaattaatacaaaatataattacaactacaaat
ttaaattcaaataaacttggataggttcatttatacaaagctagagtaaa
aaatccatttaggcgaagtcaaggattaatgttgaaaattctacattatg
aaagttaaatttaaattattaatttttagaagggtaaaagtataattgtc
tcatctaacaaaaagttctaaaaataaaaaaacttaaattcatgctccgt
ctaataagagtattattattatttactcatgtgttagtaaatgagtcaaa
ataaattaatttgattgataatatttagccattcttataacttatctttg
ataaagagataaaattttctgcttatgtaatttttttgtttattttgaaa
agatcttatttttttacaaaagcttttactatctttctttttcaagtgta
aaaccgtattagctattctttattttatacctaactattgtaatgtatgt
ctgcatttttctcgtattataaaatggtctaaattctcccgtttagccaa
gagagattaaggccactatctgtcccaaataattctagtagtgagccaca
tatatagtatttaaattagaggattcgaacttaagattttaaaattctca
aatttctaaccttattaattcaatcaaaattaaaggattcgaacttaaga
ttttaaaattctcaaatttctaaccttattaattcaatcaaaattagagg
attcgaactaatataacattatttgtcttatgtaacaggccaattttatt
cggcccagagaaaaacaaacaaaacagataaattaaaaaataaataagtc
catcttacaagcccaaaaatacagggaaaataaaaatgaatattatgtaa
tatattcggctataaaagccataacaacacatgtatctatttatagacaa
tcaaaaaagagaaatccagaaagaaactacaacagtttttttttccaatt
aaggtgccagttttttttgggtgtggctagataaagattagcattgggag
acgtctaatataacttatagactatatatttgctctatgcttcttggtga
atgctagcacattgactgaattatatcaatgacaatagatggtaaagaca
cgaaattttgtggaaggagatagtagcttagcaacaaaagctgtttggga
tgatgagctgacattgatattttgtgaactttgcgtgaataaagtcaatg
ctggtaatagaccgacaactcatctaaactcaaaaggatgggaaaatgtc
attgctctttttcaagcaaaaacacaaaaaaattatggaaaacctcaatt
aaaaaataagtgggatacattaaaaaaggaatggaggttatggagggagt
tgcttaaggaatctataggtattggatggtgtccaactaaaaagacggtc
gatgctaccgaagaatggtgggctgcaaaaatacaggttagtgttcactt
tatcattattttaatgcataaagtttattgaaattaataatttacaatta
taaaaatcttagtataacatttaatatttagcattttatgtaggaaaatc
ctgattttaaaggatttaagaagaaaggaattgagccacgattaaatgag
ttaatgtggcaaatggttggtggcattgtagccaccggagagaacgcatg
ggcaccttcgtctggtgttcttccaagtggggttcctatgggagatgatg
cacctaatgagggatttggtgattcagatgaacatagtaatgagaatgaa
ggtattccccctaatgaggtaccatcaaacccttctcatgaaatccctaa
tcgaagaaagcaaacatttggggctgtacacggtaagggaaaaaaatcaa
gttcaagtagaaaatcatcaagaaatacattaactactcagattgagaaa
ttgtgtgagagtatggctagtccaaggaagtcagtgaatgaaattatttt
tcctcactctcaatatactatttcaaatgcaatggatgctttgcgtgctt
tgggagatgaaattccaaaaagagatgaattgtactattttgccaccaaa
atgttccaaataccggtgaaacgagaaatgtttttgaacttagatccaga
tgatagggtttggtggcttcgacgtgagtatgctgaacaaaatccaattg
catcattttcatccttggtagcaacatcctcatttcccttccaaccatac
catcaaccacctccaccatcagctccttagaaatattattgtaatataac
tatactacttttttatatgtaaaactaatgtatgctactttttatgtttg
gtatttttatgttatgcttttaatcaagtttttgtgttgtatagaatgtc
acgagattttaaaggatttattttcatttgattactttttcaggttatgg
atgaatttaacaatatgtataatagttttgatatgaattatgatacctct
gaattaagtgaagaagctcaacgaagaatagccacaattgttacccaagt
tgagcacaacaattatcataatgaggaagaatatgtgttaagcagtgtat
tggtacaccatgaaacttatttcactatgcaaccgcgtatggattcaaat
tatactggtcaaatgtgggtggacgaagtattaaatgggcacgatgatcg
ttgcatgattagttttaggatgccaaaaaatatatttcacagattgttgc
atgatttgcaaacaaattatggcttaaagaatgggaaagtatcggcgatg
gagaagttagcattatcattgtacattcttggaaatagagaatcaaattc
aaatgcaacagagcgatttcaacgatctggggaaactgttagtcgaattt
ttactgatatgttgcatatatttgctcgaatgggaatagacacgattaaa
cccattgaaggtcaattcgaggaagtaccgaaccatattcgacatgatac
aagatattggcctcactttaaggtaaaatttacacaatctttatattttt
aaaacataaattatttctaacttttatctcattacttgtatttattttaa
aggattgtattggggccatagatggaacacacataaaagcatgcatttcg
ccttcttctcaaataccttatatcggacggaaaggtgaaccaactcaaaa
tattatggcagcttgtgacttcaaaatgtgctttacttttgcatttcctg
gttgggaaggaacagcacatgatagtagaatttttttgcaagcacttaga
aagcaagagttgaagtttccacaccctctaccaggtcgaactttaatttt
ttaattactttttacataaaaaatattaaaatttttaatttatttttaaa
cttgatattatgttttactttttttgcaggaaaatattatcttgtggatt
ccggatatccacaaatggcaggttttctaggtccatataggggggaacga
tatcatttacctgattttcgtcgaggtaatcatcaagtatctggaaaaaa
agaaatctttaatcatgcccattcttcgttacgctctgtgattgaacgaa
cattcggagtgtggaaaaaaaaatggccaatattaagagatattccaagt
tattcattcaacaagcaagttttaatagttattgcaacaatggttttgca
taattacattcgaagacatgcttggtcaaatgatgaggattttcgagaat
ttgagaatataccggacatgccagtctcttcaagccagtttgacagaggt
gaatcgagttcttctagcagagaaagtgaccttgaaatcacaatgttaag
ggaaaccattgcaactagtttaatgaatcaatatttgtaaacacattttg
tatcataacctaatttctagtaataatgaaacttgttatgtcttatgtta
ctatttttttttttattaaaaatcatccgtttagatacttcaaaattaga
tccaagtataatgttattatttgtgaaaataatatttatcattgttataa
aaaatatttaattataactataaaaaattaaaaataattatcattttatc
taataaataatttaaattaattatataattcattaaaatattggaagata
cattttaatattttattaaatgaatttgcatattttaataattttaaaaa
agtaaaataatttaaataacttctattatatatcaattctaatttgatgt
ccttaatagtcatttttcattttcacctcaccgctacagctgcgtttgaa
tccaaacacacactccactattatttctaatctcaccgctacagtaccca
atctcatcgctacagtaactaatctcaccgccaccgctgtttttaacctc
accggagataaacacaccgcccatccaaactagccctaataaagaaaaaa
atcttctcgggtgtgtactcaaatctctgtaatttcttagctgatctatc
tctctcaaaaaaaaaaaattgtatctcactttagtttactaccaatcact
cacttgctaaagtcaaaaaaaaaaaaaagaaaaagaaaaattgcatagct
ccgttccctgtttccatggagatctagggtttccagtggttccgcaactc
aaaatcgtagctcttcattcgcatttttcaattgcttattaaaaggtaag
tttccgagcttaaatttgttggttttattcttttgaagcttattgctttt
gatctgtggggaaactttgtttaagattttgtttgtttatgcgaagaaga
gaaaatggaggcaggtgttgttggagatattgcgtgtttggatccggagc
tattgcagctccaggagatgtctccgttagctctcaaatccaatcctgaa
ttcacgcaaacgcttttcgaacagtggctttcgcttcccgatacttacaa
gctggtacttttcgtttatctaatttcgaatcttcgcggtgtttgatttg
atttgttttctttatatcttgaacggaaaaggattaatagttattgcctt
tgtattgttctaacttgtaaccagttgattactcgattatttaatggtaa
aatatttaaaaaaatgaaaaatatatgttttatactaattaaactatatt
tgacgacatattattatgttctacatgttttatttagttaattgtaggta
tgtatgtgaacccgtatttaaagaagaaattaaggtagttttctttaatg
aattaaattgttgtgaaaggaatatttggcatccgattgctaatcttcca
gatgtaagttgattttgtgttggaggcttaacagtcttaacaaaatccca
gaatagctttttgtatattcttgaatgataataaagctaatattcttttt
tgtttttatatatggaatgtttgtgctgtctttgaagcataacatactga
attcatgtcgtagatgcttgttttaggttactaattgtttgtcaatagta
gttccgggaaatattgttccttgcatgagcacctttgggaacagcctcat
tgggaacgactttttgggaataaccttggaaggttggcgggattcttgtg
ttattccacttttggatgtcctggagagtatggcttggaggctcaaatac
tgaaattgttaacaatttcttattaacctttcttatgggaatgcaagtac
ttcctccttatttctttaatgaacaaacgttgcattaacacttaaaagcc
tttcttgctaaaatacttcaggtgggtgcaacttttattaaccgtcatta
tgcccattatctatataaattaccttccattttcccatgttcaagtaacc
actttcaataaataaaagtttgagcatctcatttgggacttttgatcttt
tgggcaaactgagtactcaaaaattctctctgcaactttcattctacaca
acagccagcatagctcttatctttctcagccccttattgcgtccatcacc
accgcctgccacaacacttgcttttaaaagtctgctctgatgttcctctc
tgccatctctccacgacatctcattttgctagattgtgacttctcctaac
cttaccaaaagaaccctttatgcatgtaattattcaaatttcctctgagc
ctatgtgtgcagttacacttttgtttaatttttttactttgctaggtgac
gcaattggttagtgatgcaaaggcacgcaatcccttgaatgttcctggaa
atgcttcctctggaagtacagcagcaagcaatgctttaccttccatgttt
cctgctggcagtgctcctcccctttcaccaagaagtatatctggttcccc
tcgtataacaaaacaaagggctggtctttcaaacttaggctctccactga
aagtagttagcgagcctgttaaagagttgatacctcaggtttggatcttt
tttaattgatagtgtattttcttttctctgttgtttttcttggctgtgtt
ttatctgctgtatttacctttctgttctgaagttggctataacgtattac
attggtacttgttaactcctccagttttactttaaaaatggtcgtccacc
tccaaatgatctaaaggaacaatgcatgtttcgaaccagtcaggtcttct
atggccatccagatggactgcagctgcatggtaagatacatgcacgtgtg
ctttaacatatatttctggaactcatcttatattcatgttttactatcta
tacattccagaattcaaactagtgaccagggaaatctgtaaactgccttc
atttttctccccatcacttttcagaaaaattgatgttaatggcactggtt
ttattacaaggtacattttctcgttcatgaaagtggaactgctgatttat
atcttggatctatcatatgctttgaactgctaggatatttatttgaaaat
tatgagtatttggtgctctcccagctggccttgttggagaactatgtgct
ataaatataaattatcattgacagtgataaatacagaaaatattatttta
gaatctgattcctaatctgttatttcttctccttttaattacttttcagc
tgtgatgtcattttgttagcttttactgaatttttctctaaactgcttac
agagatgcatttattgattattgggtcaatggcaacatgctgaccatgga
tatagcaacccaagtatatacaatattaaagcaacctgatctcaaatacc
tcattcaggtctttatgcatttttgagagcttaattcaactacaatattt
cttgatagtctaatagtatatgtttaaacttaatgtcttctgtacttacc
tatttgacaggatgacttcaaacctgtgctccgagaactattggcaactc
atccagggctggaattcttacagagtacacctgagtttcaggaaagatat
ggtttgtgtttaatctctttaatacctttggcggtctcctcattttattt
ggatttgggtgcattttcacttttcgattcccccttccttttacaatatc
taaggcatgttgtttccaaactgactccattaaatatcggaaccactaat
gggtgtttggtttaagtcatcttacatgccggcatatcattctcacattt
ggttcacaaagactatcttgagtcggtaatcttacatttccagtagtgcc
aagattccgaaatatgggggggggtaatcttaatacttttaactttttca
taggtaatataagattctggggataatcttcatttatgacatttttaccc
ttctttaattttgatcagatttatccctttattttatgacatttttatat
atgaagtaaatatatcatgatatatttttaaaaactattataataaaata
ttttaacttaataaaataataaaaagtaaattagttatcatatttaatat
aaacagtattttaatctaatttaaaaattatctaaaatacttttagtaaa
aagaaaaatgatatgtagtaataaaaaatttgagattagcgttttcaaat
aatggaataaggtttgtatttgaaggaatgtatttttttttcatggaagg
gaaaattaatataattaatatattaattataatacgactatgttaaatgt
aagttttaggtgtttgtaacaaaaatgagaataaaaaattgggggtccaa
tggaagagctccaagaactttggtgtccatatcttccaagtaatgctgaa
ggaattaaacttgtttaagaaaacaaattctataacaaagacaatttatt
aaaatgtgcttttaggtgatcttacattccatcaaccaaataatagaatc
tttacattctggtcaaatgaaccacacagggtactgtaacatacccagta
atgtgttaagtaatcttacattccgctaatcctattatcagaggcaatct
tacattccttgaaccaaaaaccccctgagatctgaacttgcaaatcctgg
aaatgcatctatttccatgtgaatttctatgaatgcagctgtttcagtga
tatagttctgtctcaaatgtgtttgataatgtataatgctatgttaattg
ttaaaaacaattgataaaatgaagaaagcatgttgacaaagcaggagtgg
aagcctattctttgatgagctagtgtgcacttctcttgatggaagcataa
ggtgcataggaaacaggattcagattcttgtttagaatgttggtcacatt
atctttagaaagaatgattggccatgtagttcttattctagtctctagtt
tcagtggccaggcttccattttctaaaatgcctatcttcaggatgatttt
gcacgataaattcttataaacacatttctttttagtttaatccggagtaa
tcttatgttgttctgattataatggggctgattattgactttttgatgag
catatgagaggggttgccatagaaacatattgtatatattgtgtaactga
atgtgaaactaaaatatcttagaccaattcaagcattacagcttaaagaa
tatcagtcttaacatgttgggccccttcccattatatatgctgtttacta
ttgctcaaacagttaatataaactgctacctctgtgctgtccaattgttt
gctggtctagattgtctctcgtgctgtcaaatatgttgttcattttgtct
gatgttgctttaacataatttttgtttcacatggccagctgaaactgtaa
tatacagaatatattactacataaatagatctcagaatggtcgcctcact
cttagggagttgaaacgcggaaacttgattgatgccatgctacatgctga
tgaggaagaggacattaataaagttttgaggtggagatctcattgaatgc
atagagcatgaatctggtttttattttgctttaaattctgcacaatcatc
aatttgtataattgctttctgatgcatgcttaatacattctgtctgatac
cagttatcttgacatttcagtctttttctcttctttaacatttctatgta
caggtacttttcatatgagcacttttacgtgatatactgcaagttttggg
agctggatacggatcatgatttcttgatcgacaaggagaaccttatcaga
tatggtaaccatgcgcttacctaccggattgttgataggatattttctca
ggtttgtccgaatcagatgccatttttattccttggtccaaaccacatta
tacttgcagaaggaagcttttcatttaattgaatttagtctattccactt
tacccttctatcacttttcctgtttcattgattggcttattttatgtaca
aattttgaacttttactcatgttatgcttccatcacatcttaggttccaa
gaaagtttaccagtaaggttgaaggaaagatggggtatgaagattttgtg
tactttatccttgcggaggaggacaagtcatcggagcctagccttgagta
ttggtatgtttgtgctctttctctgtacagtcaagggtattatagtgttt
tttgttcactgattatcaattttaaagtttacctccttagtgttgagtga
atatacctctacttataaattcacttgtttggaaaaggcccccaaaatat
ttgaaagcctatttttggtactcctcacccaaaaattttgaaaatttgat
cacattaagattggagttccaagtaatttttcattcttggctagtttttc
ccaatgtttttatttccttttgtaggttcaagtgtatagatttggatggc
aatggaattctaacacgtaatgaaatgcaattcttttatgaggagcagtt
gcatcgaatggaatgcatggcacaggaacctgtgctctttgaggacattt
tatgtcagataattgatatgattaagccggaggtttgccatttatcgttg
ctttcattttatttcctgcctgttcagtatggttcctattggagtgtgtt
caaggaaatgaatcagaatactcgttttacagcttgtaaattcaaacttg
gagaattgtgctggtatagtacaactgtctagagggcagatttctggcaa
atattgtgtttaatctcttttcatgttcctttggaaggtgatttatggca
ctatgtaataggcgtgatttaatgagctaattatattgttcctttggaag
gtgatttatggcactttgtaatatactagtttgatcttttaggagttgac
tttccattgaatgttcctttctataggctcaattgaaaatagattatttt
acgtgtttagcaattgaagctttcttgtttgcaggctgagagctatatca
cattgcgtgacctgaagggctctaaactttctggaagtgttttcaatatc
cttttcaatcttaacaaattcatggcctttgaaactcgtgatccattcct
catacgtcaggtacatgtgatagtttagttcttccttgtttaatattacc
gttactaggaacgatataccatcgtatttccatgcaagttttggataaca
gcctcatttatgtcggaacaaacaggagcgtgagaatcctacattgacag
agtgggatcgttttgcacatagagaatatattaggctttcaatggaagat
gatgtcgaagatgcctctaatggaagtgcagaagtttgggatgaatcact
tgaggctcccttctaagttgaatagggtaagcttgtccagttcatgttgt
gctgttctatacttttcctgccttttttacaaaagagaagaaaattagct
gtgtaaaagaatgcactagccaatgcattgcatgctggctatcctgcaga
ggcaccggattgaagaataaacgtttataatcaagtgacctggatgttca
tggaaactcagacaccaagtgtttgttcatcacttatacttatttttctt
ctatcgtcatatctccacagatgctcagagaagagctcaacacacttata
tgctgggcaccataaagagaatgttgcctttatgggcgaagaagatacat
tggatcacgttggaggaaaattttgggcttggccttgtggagcgtatatt
gattcaccagtgaggggtttccaggccttcgcatgcatgattttacagaa
catgatgaagcatgcaattggagtgagctttatgtatacaaatttcacat
ggccgaagacgataatcaaaatccaggcttaaagaatctctgaacatttt
aattcccgttccattctcgatttctaaggtacaaactaagtccgtatttt
cctctctgggatctgggttgattcatttagtagtgtaatttcagtggtat
ggttgagtgtaggattgtcctatttttaagtttggatcatggtttggttg
tgtagcaattgtttttggccccctctatttgtcatttttcaatttgggtc
gctccatttaccattgagttgtgttatgaatgaaacatagattaatggtg
ttgtattatgaaaattttcaaatctgttgtaagttaattgaataaaggag
tgggagttattttggaagtgcaatcaagaatcattgattaaaattcctcc
tgggagtggatcgatgtttcataatttcgggcatgcaaacataacatgaa
cacaatgtgttatttggaatcaactctataatggagtcatccgagttaat
tttattagcgcaagccccgatacaatttgcttcacggttttctacaatat
ttttaagctttttcgtaattttatttttttattcaaataatgaagtccat
tttagatgaactaaacatgttttaacgagtctaaaggcggaattaggatg
tactttgcataatatttaaaccgcctatgtttgttggtttagagagtagg
aaattaaatgtttcttaattaagatttcggtattgaatatttttggctag
tgactattaagatcttaaaagaaatttaaccctgcatccatttcagtctt
tcacaatcaaaactagaaaatccaaactgcaaaatctattttctttgtta
catgctacaagaaatccctttctacaaagtttataacttcttatgaataa
taataatgttatatctccactcgtgataggatacctgataagctaagatt
acgcttgaagtcacctataagttcacccttccgagatgactatctaggca
acggatgacctaatttttattgggagcattaagttgttagtcaacaaaca
tcacgtgcgctaattgttttattccatcaaagtcaaaattaatgatagaa
tttgccctattacaaacattctcgtcccatcgaagacatccttctcatgc
tctccataatgatgactagatgacaagtccaacacgttaacaccatctta
cacaggactactccctataaatacttctaggaacgatgaaaaaggatcga
ctttaaaagattactaagtctacactttgtcaaccttcttccaaccctca
atctttacattctcttctctaccactcctcataacctttggcccttcatc
ccaagtgagagaactgacctccacaacaacgaccactctctcctccatac
tcattccttattgtattactgtatcaacaaataaaaaaatatcaatacta
tttaagaagctaagttgatcaacatgtcttaatttaagctatgttagata
aattgaaaaactaagtgcataaaaaataaatgtttgaaaaaacaagtact
tgaaaaataagttttaaatttaagttataaaatttgtttagtatattact
taaaattatatacacaagtataattagattgtttgataaatgataatata
atcataaaagaaataaatttaaataaaaaattaaaattattctatattaa
gtgataaataggttctatctattatcattttccacacctttatttttaga
aaaagaagtttctatctagtagattttattgtgggtcatcaaacatatta
atttttagttggttgatttttttgacattttatcaaacaagccttagtta
aaaatgatcaaaaatctattctttttataaagactatagttacctctttt
aataatgtcgttttcaatgttcaaacacatattcactctttatgagtgca
atgtgtcaaacaacggcaattgttagttggtaagtaacaaatattgttat
gatagtgtttttgtttttcatatttctatatacaatctaacaaaaaatgc
atacatatgataatatttgaacttaaagcactataaaattttaatatctt
aattttattatttcaactaaagcctcgtttaaattttatattaatttttt
tataaatatatttgccatgaaatgctttcattaagtttccgttgttgcac
tgaatatgacttctgaaaaatgatttacttttttagaaaaactaatattt
tctggtgtttggatgaatctgtgtaaaatattttatgttgtttgacggat
ttctggaaaatatttcataaaagttgtttttaatagaacaaacattcatt
atttaattgactttattttgtatctataaattaatatttcacattgtttt
tgcatacattcaaaatattttattaaattcaggttcattacaacgtcatt
ttttagttacatgactaccaagtaaatattttttatttaaaaatatgaca
tcaacaaaattgataaaaaaattaataatgttaacaattggacttgattt
tcaaatttgaaaagtagagagattaaattcttgaaaataaaagtacttag
actaaattcaaagtgtatgaagtgtacatggacttatatagcatatttta
atttttatactacaaacaaattattattaatatatttataattgtaagaa
atatttattattaaatattttcaataatatatgaggaatattacttaaaa
ttattatttttaaaatttattattaaataaaattaaaatagtaaataatt
tattaaaacaataaattatattaataatctattatatgattaaatataaa
taattaaatatgtatgtttaataatattgaaaattataatattttaataa
ttttaaaatagttttaaaaataaaaataaaatttattattaagataataa
tattaagtttgatttaatttaatttttataaaaaaataaccataaaagaa
atttttttctgaaaaataaccgacggcttatttttcattgactataagta
cttttttattatcaaaacataaaaatatataataaaaaaaaacattttac
ttttaacacagcttaaaataaatcaattttagttaaatatttttttgggc
caggaataatttcaattctaaaatagaaaaaagtgaagtggcaatttgcg
aagagtaaatttgtgctgtccgtacaaaccaagctgctgtgctgagctgg
tttttttttgacttgaagacagaaaataagagtgtgttaaaccctaagcc
ctttcccaagcggcctcctggtctcatctcacaagtaagagattgatcaa
ttcaatttccgcaatttgattcaacagcagacatacagaaaatgaaggtg
gttgctttagtcagcggtggaaaagatagctgttatgctatgatgaaatg
catccaatacggccaccaggtttttctgtttgtttccctagaaaataata
ccaacaatattttaaactaaaaactcataaagatttgggaattatagtgt
cttatacgagaagggtacccgaaagcagtactagtagatgtcctttcctc
atttttttccttagaaattaaaatttctggttattaaaagaaattgactt
ctttgttgcttttttatttagattgtcgctgtggctaatttattaccagc
tgatgatttagtggatgagttggatagctacatgtaccaaactgtaagtc
tctgctgattctcgtcgtttgatttcacttatttatttatgttttgtaag
aaagtggtagcaaaatcatactacttcaattgtttgacgttaagagtata
caaagtatgcttctttgcatgagttggacatgaatattgatttttttttc
tttcaggtagggcaccaaataattgtaagctatgcagaatgcatgggagt
tccattgttccgaaggcgaatacaaggatccacaaggcaagccctttaaa
cgagtattgtggtaaaaccatacatctttgttcagggaatttatgatttt
cactttgtatcacaattatgaaatgggaaaaaagcagcatctttgcttgt
catttcacaattactttgtttgttgtgtaccttgggcttttccagttttt
tagttatggcatttccttcaagttacacaatgttattacgagctttgcag
tcttttctgtgtgcatatcatgcgattaacagattgtactaagtatgatg
ctggcaagtcatatatttctctttcacagcataatgatctggttacaaca
ttgaaaatttgttaatccattttgtaagtaggcatattatgaagaaattt
acttaatatttggttgagatgattttcagaagggctgctgtttagtcaac
tttcagctaagcatatgccctttcaacttgacaaatgaacactatacaca
ttttttttttttgctgaagcttttggcgattattgtaggcaccataaact
tagctaccaaaggacaccgggtgatgaagttgaagatatgtttattttgt
tgaatgaagttaagaagcagataccttctataacagcagtttcttctggt
gcaattgcgtcagattatcaaaggctacgggtggaaagtgtctgttcaag
gttagggcttgtttctctggcatatttgtggaaacaagatcaatcattgc
ttcttcaagaaatggtaatttgtattttgttaatatgaatacttaataaa
aatttagatggtttgtttttctcacatattactgtctgttctttactgtt
cagataacgaatgaaattatggctatcacagtcaaggtatgtattatctt
tgatgaattctttcttattgttcttaaatgtttgtttagaaaccatgtga
tgtctttcatgcttgtgctatataaatttactttctagctatttctttta
tgagatgttttatcatatctattgtagttgaagtattgtctgtttcatat
tggattattatgccataggttgcagccatggggctggaccctgcgaagca
cttgggcaaagaaatagcattcttggaaccttatcttcataaactgaaag
agtatgttagtgctgttcctctgtgtgtgtgtgtgtgtgatgcatgatgt
accttttaatatttcaagtgtggctggaaacttaaaattttctttttgaa
ctcctttttggcagcttgtatggaataaatgtatgtggcgagggagggga
gtatgaaaccctgactcttgactgcccactcttccaggtaagcttttctg
ttgactagtcccctggtgaaatatttaccttctactcatggcttcccctg
gccttcaaccccaactctgtctttctttcattttaatagtttcttttatt
tattcccaaggatttaattagtattcatgttctgaataaaagaggggggg
ggggttgcaactcagttgcatttaacagattctttgcaagtatttttttt
cataacttttaaggtctaaaattttcagaatgctcgaattatgcttgatg
acttccaagttgtactgcactcttcagattccatagctccagttggagtg
ctgcatccattgaaatttcatttggaaagtaagcagtccaactcattaag
tggtaataacaaaaccaatgatctctgtcgggagaatatcagttctatat
tcgaagtgcaaggagtaaacctggaagaatgcaaagctccaggcgagcct
ggtcctgaagttaatgatttgattgaagtttcaagtcataggcttcacct
ctctaaaacggaaaaagatactacattttctatttgttgttggttgcaag
atacatcaggaccttccacgggtacaaaatgactgctgtgcagatttgtt
gttgtcatcccctgcaacataatgttcctttgtatttaaccattgtttcc
aaatcaaacgctgcagttaataactgtttcctgttactttttgtttgata
ggtttgcaaggagacctgaagctgatccttaggcaaattgagttgcagct
tgaaggatgtggtttaggttgggagcatgtgctttatatccatctctaca
tttctgatatggatcagttcactcaggcaaatgagacatatgtgagattt
attacccagggataaatgcccttttggtgttccatcgcgaagtactattg
aacttcctttaattcaagcgggtttagggagagcgtatattgaagttcta
gtggccaatgatcagagcaaaagagttttgcatgttcaaagtatttcatg
ctgggcaccaagttgcattggaccttatagccaggtactctgaatcatgg
caattggcatcaatgaaagaaggttcctttttattgcatttttatacttt
atatttttcaaaagaatattgaaataattaaaagaaattgtctgacagta
agatacctttttcacttctaactgtctggttgattcttttttcccagtgg
gtgtgttggggtggggcttaattgaaaggagtgaaacacaataatcgttt
tctttatggcaaaagattgaattgagagatgctcaggaatcataaatcat
taaggtttcattcataaatgttaaaagatgactggttttttttctgaaca
tgcctgatatttcaatgaatgtgcactctttctatccacatgcagtccag
tcaacttttaacttgatcaatgttacttttaggcaactttgcataaggag
atgctacacatggctggtcagctgggactcgatccaccgacaatgactct
atgtgatggtggctcaactgcagaacttcaatcggcccttcagaacagtg
aggcaatagcaaaatgctttaattgttcaatttctacttctgctattctc
tttgtggtttactgctcgacgaatattccattagatgagagaccaaaaat
tcacgacaatctggatacatttgcgaaacaacttaagctgtctcatttgg
ataaagggaccaagcctgaagtgcttgatcctattttcctttatattcta
gttccagatctgccgaaaaggtaaatggtccacacttaacttttgatgaa
tcataagggtgctgatgaactgacttctaaaaggaaatgttcaccttgaa
attgtgtttgtttttctttttggatgtataatagaagtagtagtttgtgt
tgtgtccaacggaagggcattccatcatcttctgtttttgatattgcaga
gcacttgtagaaataaagccgattctttatgtcccagagactgtggaaac
acctgaagaaacttcctgtcaactttctagcatagtggcacctagttctt
ttggttttcaacctgcagattggcctgattcatgtattcagaaatgtgtc
attcccggaaagatatgtgcggtggttttgtcaatcacaagtgtagttgc
tatgaagatttgttcacattctatgaatgctgattggagcaacaataatc
atcagaattctctcacagagagtcaaatgaaaagaatatctaggttttgc
atctttcttctaaacaaaaccattatcgaaaatgatttttcttggaaaga
cactatggtaagtttcttaggcaagcacctcattttcctttaatattgat
tctaaatagagttatatcctgttgaaggttaggaaaatgcttcacccaga
aagtttattttggttattggttcctggatttgtcacttgtggttattatt
tattttattaatactctcctttaatgtgttatattcttgccttactgttt
tcattacagttcctcactcatttttctgcccaatttttttttttctagag
tttgagactctacttcccacctaaccttcatgtgcctatggagacattat
caaacttgtttgcggatggattcaaggaacttgatcagatgaatggtggt
agcaaagtaggcgggaagcctatcttcaatcttgttccggtcctaggtgc
cggaatatctgctgcatgtacaaatgatataatcacctgtgagctgtttg
ctgggaaatcttgatcctttacttcactttggcaattccatcatttgttt
tctccaagggatggttcagtcatcaaagaaactcctttctgaaagttaaa
acagccacaccaatgtggtttgttcttggatgaagaggtaatgcttttgg
tcaattatttgttagatttattgtctttacaatcaagtattctttacatt
tcaaggaatctaaagaaccttggtaaagtcaaatttaaatgttaattgca
agattttgtgatatattctgattgggaatttcttgtttttgtctactgtt
atatataagaaggcctcaataatagaaaaaaccctgaactttaccatttt
atctagttaagtccctatatttttattagtccaaaataaatctaataagc
ccttaacctttaacttgtacccaaataagtcccaagctttaatttatatc
taaacaaaccctttaacataaatcaacatgtcatgcgaaataacagctta
tttaggtacaaataaataaaaaaaaacaatagcttatttgagtacaataa
aaaaaagaggggctaattttaaaagaaatgaaatggttagatcctttttc
aataagtaaactataaagtgtagtgaaatgattttccaaattggggcaaa
caatttgcatgtgagatgtcttcatttcatcaaaattaggttgtcaccac
aacatcctactaatttgattgcaaagcatcaaatcatcattattagaacc
ttgactaagccccatgtccaaccatttgagaaaactctgtgccaagtcac
atcttctaatttgtcttaatgaggctgcttagctttgttgttttttggta
gttatgagtagctttctagcaatttgcttactttttggcctttagttctt
ggcaaaaaaagtttctaatcagtcaagtctagagttctgcttatagcttt
attataagaatacgtaattatggatgtaacactgcacgaacatgatatga
tatatccatgatatgattaataagaaaatagtgtgataaacacaattaac
ccgacttgtttaattggattattatattcgtttttaggaatatcatgttc
atgttacatgatatatctgtgtaattaccttgttcttttttatctaatgc
agcaaactctaaatgtaatataatgctaccaaattgaaatatgccattaa
acatctttcctccttccccccccccctcccccttttctatatttaagttg
gtttatatagaatttaggctcataaactgtacattttatgttaatatttt
gatggatatagatatttgttatgggaggaaataacaattttttggaactt
cacctacccttctgcttgtcctttttcctctgtcttataaaaggtacgtg
tgtgtatacatggttaaaatgtgccagaagtctctgttacaacaataaat
ttaacaaaaagaatttaacagttaaacttgaattttgaaatttaaaaatt
agaaggattaaattccatgaaataaaaataaaaagattgaatttctaatt
tttgaaaaatacagggacttctgacacattttatcctgtatacatacaaa
ttttatcccaataattcaaagaaatttaggagttgtcactaactgtacaa
attatagcctctttgtacttgaagtacaaactcagttgccaatcatatca
cccataatctatggtgataattgtggccgattagcaattatgagtatcaa
atatggatattcttttttttcctatatatatatatatagaagatcatcta
tgtatatccactatccacctttgaatttatggacatagatgtcaaagtca
tattttaagtgtattattatgaatttcattcctttatatgaaaattgaga
agataatctttgtactttaatttatttgaatttgatcctcatactttaaa
ctaagaaattattccaattttagataccattgttaaattatgtcactaaa
ttgaaaatcactacacaacattatcaaaagtcaacaattcaaatttccaa
atctaccagtaatagaattaatttcttgattttgttaatgtttaaaacta
aattttgatatattaaagtagagaaattaattttttcaaaatttggaatt
tataattgaatctattttaaaaggaaaagaatctaaagaacatagatcca
aaatgtatctctcaatggaccattgtttgttcagctataaataagtgaaa
agacctttgaaggagaggcagagaattgggtcagattttgaacccagacc
ctcctctcaaaccctgtccttaagagaaaaataaggtgataagtgccaag
gttttcaattatgtccatgcccataagttatggtgttttcactctttaat
agggaaacacaaagcaaagcaacaaattaacaaaattacaaaaggttttg
atgatgggaaatcacagctcacatggggaaaaaagggggaccaatgacag
ttttaaagggcaaaatgatgagtgtgttaagcaaagaaagcacatttgaa
gctcagtagcactgaaatcatatggacctcaacctctatggtccacaccc
ctccttaaaatagccctaacaaagtactaaagtttttagtaaagagtggt
ttagctttttgcatgaaatatgttagaaatttggaatcccatcagatcta
acattaataaacctaaacaaagaaaaaagagtccaattgtttgcttcatg
tgttcatgaaataagagatgatgattacctctttcttgaatttaactctc
aaattagcattgaggttgatggaagaatctgatcaatgcaatactgttac
tttaaaattttaattaaaactttttgaagtttagtgattaatttaaattt
taaataataatttgaggtataaaaaattaactatatttttatacaaaaag
agttacaatttgtaataaaaaaaaacataaagttcaaatctcgaatttat
taaatatcacatgccaaaagaataatatttagggtgcatttgtttctgaa
atagctttaagaaagtgattaaaaagaaagacatgattcttaaggctgga
gaaaaaaagaaaggcttgagatgttttatagaagataaagagtgtaaaaa
agagaattatgtaaaacatcttacggaaaatgaactcgtggaatagattt
aagtacaaatctttattaattttagattatatatttagatatttgattta
tttttaattatagtggtagtaactgtaatttaattggcgttaggattgtt
gttagtacaaaaagatatgagtttgagtacgttgaagtacattatctttt
tatttaaagattatagagagactatgggtagttctagttattatataaaa
aaataaagactaaaaatcgtgatattaccctcatatgaaaatgagtaaga
aaaagttatattgatactaatttaatcctaaattctttatattattttta
tattttgggaaaaaaggaggcattatatacaattcaacataataataata
atattattattattatctcctaggattgggccaagacaagagacatcttt
atcataattgaaaaacgaaacaaaaatcgacattttcttagaaatagaaa
ttaataatttcaacacgtttagtttagtccacgttttcacattcaatttt
taaaaataatcaaattgttgaattattcacgttacttaaaaatatatttt
aaaaattgcgttaaaagagaaaaaaaaatcaaataaaaggttttttaaag
ctataatttggagttttaaaaggaaaaagaagaagaagaagaagattatt
gttggaatcaagaaatgctttgtttgactttgccatcaggaaataaaatg
caatagaaatggcaagccaaggttagtattgtcaaaactaggggcagcta
cgtcttttaagatgcgaaaatttgctgtgacgacgagaccaaacacgcag
aaaatcacccaaattgcaattacattagtgcatttttaaatttatatttt
atttaatatataattattctaattaaacttagaaaatagatgtcctatta
atcgttcttggtgtatatatatattatttatttatttatttatgttttaa
taaatataaatgtaataaaaatgtggaacttttagagagtttctttttat
tcttctaattttttattttctaaaatataaatttttaaacattattctcg
ttataaatttttatcatatatggttttttgatataatgtctaaaactacc
cataaccccaccctaattcttatatagaagaataatgcatttcagcgcat
tcaaaccaatatacttttgcattaacaataatattgatgcctctaaaata
atgataatttaatattatttatatatatttttaaattatatatttgatac
ttatgttgagtcaaatttgtcaattaagttcccttgctataatcattttc
attagtcaaataggaaagaagtgttcaattttaattaacaatcgtagttt
aaaacctatactttctaattttttcatgcggtgaatatacaataatattg
aaaggtataattctattaactgactttttaatcgaaaataaagttgtgat
gggaataattcattatcattgctaaaagtagttgttagattgttaaacac
attctttgaagaagcgggtaatttatatagttacagaattaattcgataa
atcttttgaaatttcaacttaaatttatatcatttaacatcttagagctt
ccatccgtagcttatcagaggagtgtcaatgtcagatctggcaatattgt
tgttttcatgtagctatcattattaaccatttttcaaatgaatagaagat
acagttagcgttaatagttttggcattcacatacaaggtgctttgtaagc
tgttcctgtgggatatgaatgaaataaatggttgcattctacttttacaa
gtgctatcccgtccgctctatatgctttctatcatgaaaaggtaaaaata
taagcatatgtcatagaatgattagattataaatgttttatacagtagta
attacatttaatattttaacaaatggaccgatactttggattatacaaat
tatataaaggtaataatttagttgtgatcacaaattagtcgatttttata
tgatcatgtaaactgctagtctattcgtatttgattaatattagtaatta
gattacacatatgcgtgtggaaatcatgtatctaaaatacaaatttgtat
tttataataacatccatcaaataatgaaactaataataacatacagaatt
aaaataaaccaaatcaatttaaattatgagtaaaaaaatatttaagtaaa
taaataaattcgagtaaaaatatttaatgcattccaattaccttctagct
agtattgctatttttcaatagcaccatcgaatgttaccatgttagagaac
tttatttaacataccattaaaatgttattatgttatcaatattacaaata
taaataagagggaaaagacatttattcattccgattagaagaaaatctta
taaacaccattaaaatttatctactaaataaattaaatttaaataaaaag
actattatttttatttatctatgcattttaaatttatatttgtaaaatta
attagctacaattatttagaagatttcaatgaagaggattattaaaatat
aaaagataaaaagaaaaaaggattacatttactttggttatgtctcatct
atatattatgtatttattttggtttaggtatgaagatattataataatta
tcagtttggtcatgttttttaatgattaattttggatatagctattcaaa
tacataattttaattatgattatatttgtaacttaaaataaacttatata
tattaattcaaaacatatattatgttttacatatgattatattagtatat
aatatcatttataatttaatttaataataaaaatatttttataaccaatt
agatttttaaaattgaaaatgattgaatataaatattttgtagattattg
aatataaatattgaagaataaagttattttttatttaaaatttatttaac
aaaaaaatcataattagttagtttggtatttttcaaatcatggaataagt
gatttttttatcaaaacttaagggatttgaaccatttttatatttaaaat
tattcaatttaatattaattacaagttaatttaatgattattaatgtggc
attaattatatgtaatcattaacattttcatttgttaaattttattattg
agggaaattaattgaatgaagttattgaagtgattaattaatgctaatca
ttaaaggaatttaatgataaattaacaaatcttcttcaaaaagtaatgtt
tataataatttaaaatagaaatttaaatgacttcatttattggttaaagt
tattgttgaaataactattgtattttagggttattggtagatacataaaa
aaaaagttaattattttaacataatatttaaaattatctaaattccttca
ccaatttataaataaaaagatattgtgttttaacgcactcaaatttattt
cctcttatattgacaataatgtccatactaattaaattaagactcaatta
acactcatgagagaagttataaatattgtgatatttaatgtaattatatt
taaaaaataaaaaattatatctaccgaatagaataattaccttaatattt
tcatatttaaattaattaattacattctaaatggggcattctttaatgaa
tcagtgatttaggccgggcagaataactgccgtgaatggcagaaaaagta
atttcatatgaaaacgagggacatttaacgttccaaaacggcaagagaaa
agggagagcgaaaaagttaagagacgggacctgaaagtatgcagagggga
aagaaaatggtttgatagatagaaaatcaaaatagatacagaaaaaagcg
aaagttgctccagagagatctcagctaagcattgaatttttaaagaggac
tgagccgagttgtgctttagaggtgagtctatgtttagaagattcagatc
gtgacccgccggatccagtatcctctaattgacagtagccgtccgttcta
gctccttctttctctgaagtttcaacttccacgaagccaatttgaaaggg
aaaggaaaaccttctcgatccgcttgcgtttcggatttttatttggatgc
tgcacctgcttcctcaggtttgtccttctatctttttcttttcctttttt
aattctgtttcttttttgtttggctgcctagaaaatgaacgaaagtaaat
gtagaaggaatgaacataaatgaatattcttggtggttattgtaaaaaaa
atgtgaaatttaatttagtgtaaactagtgaaaacatttatgtttgattt
tctttttcccttcttttctgtaaatttcatattctggtgtaaaaatggaa
aaatcaaaattcttgtgctaatatggaaattttacttattgaagctcatt
ctcgtttactttcctttatggggatcgcatttacagatttgaactccgtg
gaagctttaacttctctgtaaattgaactgagggtaaaaagcgtacgtca
tttgagcagatgtaaagaagttgccacattgccaattattatcattttta
aactaaagctagtattgaagttgcatagcaaagcctaaaagccctaatga
gtagttgtggaaccttatcaaaatttgaatcgtttatcttaaaatgtagc
gttttggagaatttgagattatggtgggagtgtgcttttgttaattttta
tgttttcaatgatagggtattggacatggatgaaatgatagtggagtagc
ataattctaagcagagaatcaagtaaatggaggatctttccaagtatgcc
catagtccagctcatttagctgttgctcgccgtgagtatgctgggcttag
gcgcattatctcaacactccctcggcttgccaaggctggcgaggttaata
ctgaagttgaatctcttgaggctgaggaacgggctgatgctgtctcgtct
gtcatagatcgtcgtgatgtcccaggtagggagactccgctgcatttagc
agtgcgattgagagatccgatctcagcggagattttgatggtggctggag
cagattggagtcttcagaatgagcagggttggagtgctttgcaagaagcg
gtttgcacaagggaagaggcaatcgccattactattgctcgacactacca
gccgcttgcctgggcaaaatggtgtcgcagacttcccaggattgttgcct
cagcagctcgtatccgtgatttttacatggagatgtcttttcattttgaa
agttcagtcattccatttattggacgcattgcaccatcagacacttaccg
catttggaagcggggttcaaatctccgcgctgatatgacacttgctggat
ttgatgggttccgcattcaaagatcagaccaaacatttctctttctaggg
gaaggctacacttctgaggatgggaatctttctcttcctgcaggctcttt
gattgttctttctcataaggaaaaagaagttacaaatgccttagaggggg
ctggtgcacaaccaactgaatcagaaatcgctcatgaagtgcaaatgatg
tctcaaactaatatgtataggcccggtattgatgtcactcaggctgagct
tgttcctcatttgaattggaggcgacaagagagaagtgagatggttggaa
actggaaggctaaaatttatgatatgcttcatgtgacagtcagcgtgaag
tcaaggagagttcctggtgcaatgactgatgaagagcttttttctgtgga
tgatgaagaaaggatggcaaatagcggtgaacaggatgagtatgatgatg
tattgacagctgaggaaaggatgcagttgaattcggcgcttcgtatggga
aattcagatggtgtttgtgatgatgatgagcatggagttgtcgactgtca
agaaaatggttcagcaggtggctatgaaaattgtgaatcaaatggtgttg
ctaaggagaagaagagctggtttggctggaataagaaaggctcaaagaac
agtgatgatcctgatgattcaaagattggaaagttctcaaaatcggctcc
tgaaggtagcaatcagagacaagttgataatcatagatcgtcatctgaat
ttgcaaaggaaaatgctgtcgatggcaagaagcgtaaagataaaagcagc
aagaagaaggagaagaaagggggcaatagtgatgataaacatgaaagtga
gtataagaagggtttgagacctgttttgtggttaacaccagatttccctt
taaagacagaggaactcctgcctttacttgacatattagccaacaaagtc
aaggctataaggagattaagggagcttttaacaactaaactgccatcggg
cacatttccagtcaaggtaatgtaagacatatgaagccaataactcgaac
aattatcttattttatggtaaaaatcttgtttaggcttcaaagttgactt
ggagtgatggtcatgtctgaaaataaagagctatcaatatctttaggcag
gaaaatatgtcctgggttagagcgaatactgaaattcgtatgaagaacac
tttgctggtcttacttgcttatctcctgttatctaatcacctcattttgt
tcacattaattttaacaaacacaggaaatgggtctattaatggtatcctt
ggtcctatggtgttgaaaatccaaacacattgttttgtaatgattggaaa
ttaacttgaatgagagctgaagtaggggcttgttttgtgtcaactagtga
attgaggtctggaagtgaaatagattgttagcttattgttatttgagaat
tacttttgttaaggtaaaggaaaacttaagggcatgcatatcataagcca
ttcttatgttactaatggtttaatatatattttctggttgaaaatcttaa
gtgggttggccattacttgatgcttttggacctaggctcaagtcactagg
cgaaagcttaggtctaatataggtattaagagattgtcttgtcatttaat
atttcaaaatgacggagaagccacttttaatgtcgatatttaggtttgcc
atattgctggaatcccgcataactcttcattaaaatacgcattatatgat
tccgacattacaaagcacggttttaattgttatttacatttctccatctg
tatttctggttcaggaggcccccttgtcgtgaatgaaccagatgcaatgt
gcattatagtgtggtggcaaaatacttccctatttcttcttgccagttct
attgtccttccttctaacactttaatcgttaatgttaactttgagaatgg
cccttatgctaaaagatcttcattttaaatgtttgtctgtggaaactgtt
gtgcaagcatgatagaaagtggtgatgacttatgattcagagtagtgtct
aatatcataaaacattccaatcttgcacattgatgtctaatattccttat
tctaggttgccatccctattgtcccaactattcgagtccttgtcactttc
actaaatttgaggagcttcagccaatggaggagtttgcaactcctccttc
cagcccggttcatttccaggatgccaagtcaaaagaatcagagggttcaa
catcatggatttcgtggatgagagggagtcgtggtggccagtcaagtgat
agtgatagccaccggtatagggacgaggttgatcctttccacataccaac
cggctatacctgggttgatgcaaatgagaaaaaacgtcgcatgaaagcta
agaaagccaaaagcaagaagcacaaaaggcaggcagcagcagctaaaggc
ggggatggaggtcagcagcaggtgactgaagaggtggaagaataattaca
ggatcccgggtgttttaccctttcagtggcatctacaacagatttaggag
gtaaggctactgcctatacacatttgatattttactaattgcaattggcg
aaatgcggcagttgatttgctgaatgattggtagggggaatgaatcagtt
tgattaaagaaagaagagccttgtcttcttctgttgtattgttatgtgat
gtgaaattggtttctttattagtttgtttcagttctaatttttattggac
attaaatctttgtatctaagtccatggtcgtcaaatgttccttttttgtg
attgatattctttttcctctcattgttacttcttcataatgatctttttt
caccttcgtcttgtctaaaggcaaactggttaagggttgagatagatttc
aagcttgaaacattgagtgatacttggtactcgaattcgggtgcgagtat
cacaaacatctaaagtctaaacccagatgagtgtcaaattctgtacacac
ttaattttgtcaagttatttattggtttaagtccattccattttgagtgc
aattaaatatccaattggttcatatttcttgaattatgaggttttagtag
cggtattatacttggataaaatttgagatttagtctttatgcttaagtct
tctcccttttttttgattagatcgtccgcactaaaatgtgcacattgcac
aggttaaacctcaatacctagtttcctgaatagaatgaattagcgatgca
atacaatttttatagtgtgatcgggtagactaagctacaacgatctcaaa
aatatagaaatcattaaaaacgggacaaaattgaacatacatgtatggtt
gataactagccgaactttgaagctatttaaatgtttcgttctgtacattc
ggtaccgagctcga
back to top