|
Analyses
This region is derived from or has results from the following analyses
Publications
Year | Publication |
2015 | Tuttle JR, Nah G, Duke MV, Alexander DC, Guan X, Song Q, Chen ZJ, Scheffler BE, Haigler CH. Metabolomic and transcriptomic insights into how cotton fiber transitions to secondary wall synthesis, represses lignification, and prolongs elongation. BMC genomics. 2015; 16:477. |
Sequences
The
following sequences are available for this feature:
region sequence >GBYK01000016.1 ID=GBYK01000016.1; Name=GBYK01000016; organism=Gossypium arboreum; type=region; length=278bp aaaataaaaccagactacgacaaaatttatgggcaaaagtaaagataata ttgttactaaacagacacaagaaaaatagctaaaatacaatattacacaa gcacaaaagcatatcaaaatcaatataacaccacttatttttaaaatgtc aaaacttataataaatacatgacaccttaaacatgattatgacacagaaa acaaatgaacaagccttggatacacaaattgcaaattctaacactaagtt atttcatcggacatctttgagccttatg back to top
|