|
|
Marker Overview
| Name | TAMU_Gl_148616 |
|---|
| Alias | Gl_148616_Class_II
|
|---|
| dbSNP ID | N/A |
|---|
| SNP Array ID | | TAMU_CottonSNP63K: | i69967Gl |
|
|---|
| Type | SNP |
|---|
| SNP Alleles | T/C |
|---|
| 5' Flanking Sequence | GAAGGTCCCAAGTGGGATGTTCTCGGTTTCCTTGTTCAGTATTTGTGGGC |
|---|
| 3' Flanking Sequence | TTTGGCATCGTTTTCGCGTTAATTGCATGCGGGATTGCTGTGGCGACTTA |
|---|
| Species | Gossypium longicalyx |
|---|
| Germplasm | BLC_200908137.04 |
|---|
| Source Type | RNA |
|---|
| Publication | [view all] |
|---|
| Contact | Stelly, David M.
|
|---|
| Comment | class_II: a SNP in which (an) additional polymorphism(s) was found within the same contig, but the additional polymorphism was outside of 50 base pairs (bp) of the marker |
|---|
Publications
| Year | Publication |
|---|
| 2014 | Hulse-Kemp AM, Ashrafi H, Zheng X, Wang F, Hoegenauer KA, Maeda AB, Yang SS, Stoffel K, Matvienko M, Clemons K, Udall JA, Van Deynze A, Jones DC, Stelly DM. Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts. BMC genomics. 2014 Oct 30; 15(1):945. |
| 2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>TAMU_Gl_148616 ID=TAMU_Gl_148616; Name=TAMU_Gl_148616; organism=Gossypium longicalyx; type=genetic_marker; length=105bp
GAAGGTCCCAAGTGGGATGTTCTCGGTTTCCTTGTTCAGTATTTGTGGGC
[C/T]TTTGGCATCGTTTTCGCGTTAATTGCATGCGGGATTGCTGTGGCG
ACTTA
|
