|
|
Marker Overview
| Name | TAMU_Glsp_224020 |
|---|
| dbSNP ID | N/A |
|---|
| Type | SNP |
|---|
| SNP Alleles | A/G |
|---|
| Species | Gossypium longicalyx |
|---|
| Publication | [view all] |
|---|
| Contact | Stelly, David M.
|
|---|
| Comment | Specific' G. longicalyx SNP markers, which were determined using an alternative version of the TM-1 assembly. class_III: a SNP in which additional polymorphisms were found in the same contig and within 50 bp of the marker |
|---|
Publications
| Year | Publication |
|---|
| 2014 | Hulse-Kemp AM, Ashrafi H, Zheng X, Wang F, Hoegenauer KA, Maeda AB, Yang SS, Stoffel K, Matvienko M, Clemons K, Udall JA, Van Deynze A, Jones DC, Stelly DM. Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts. BMC genomics. 2014 Oct 30; 15(1):945. |
Sequence
>TAMU_Glsp_224020 ID=TAMU_Glsp_224020; Name=TAMU_Glsp_224020; organism=Gossypium longicalyx; type=genetic_marker; length=105bp
AGGATTGGGTAGGAAATGGATGGAGAATAATGTTGAGTTTCAAGATTACA
[A/G]TGTTCAATTGGAGGAATTTGCAGAGAGAGCAAGGGAGATGATTGA
AATCA
|
