|
Marker Overview
Name | TAMU_Glsp_082005 |
dbSNP ID | N/A |
SNP Array ID | TAMU_CottonSNP63K: | i70000Gl |
|
Type | SNP |
SNP Alleles | A/G |
Species | Gossypium longicalyx |
Publication | [view all] |
Contact | Stelly, David M.
|
Comment | Specific' G. longicalyx SNP markers, which were determined using an alternative version of the TM-1 assembly. class_I: no additional polymorphism was found to exist in the same contig |
Alignments
The following features are aligned
Publications
Year | Publication |
2014 | Hulse-Kemp AM, Ashrafi H, Zheng X, Wang F, Hoegenauer KA, Maeda AB, Yang SS, Stoffel K, Matvienko M, Clemons K, Udall JA, Van Deynze A, Jones DC, Stelly DM. Development and bin mapping of gene-associated interspecific SNPs for cotton (Gossypium hirsutum L.) introgression breeding efforts. BMC genomics. 2014 Oct 30; 15(1):945. |
2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>TAMU_Glsp_082005 ID=TAMU_Glsp_082005; Name=TAMU_Glsp_082005; organism=Gossypium longicalyx; type=genetic_marker; length=105bp AGTTGTTGATGAAATGAGAAGCCTTGGGTATGAAATGGAAATGGAGACTT [A/G]TACAAAGGTTTTCGAGCACTTTTGTAAGAAGAAAATGATTAAAGA AGCTG
|