|
|
Marker Overview
| Name | TAMU_GH_TBh032N08f566 |
|---|
| dbSNP ID | N/A |
|---|
| Type | SNP |
|---|
| SNP Alleles | A/T |
|---|
| Species | Gossypium hirsutum |
|---|
| PCR Condition | Tm: optimum, 57 ; minimum, 55 ; maximum, 60 ; max difference, 2 ; product size: minimum, 50 bp; optimum, 50 bp; maximum, 100 bp |
|---|
| Max Length | 50 |
|---|
| Publication | [view all] |
|---|
| Contact | Stelly, David M.
|
|---|
| Comment | KASP assay uses a 3 primer system. Two that are allele specific, one for each SNP base and then 1 common that should not contain any SNP bases. |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2015 | Hulse-Kemp AM, Ashrafi H, Stoffel K, Zheng X, Saski C, Scheffler BE, Fang DD, Chen ZJ, Van Deynze A, Stelly DM. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences and Perspectives for Genetic Mapping. G3 (Bethesda, Md.). 2015 Apr 9. |
Sequence
>TAMU_GH_TBh032N08f566 ID=TAMU_GH_TBh032N08f566; Name=TAMU_GH_TBh032N08f566; organism=Gossypium hirsutum; type=genetic_marker; length=105bp
TGTCTATTAAAAATTTACCTGTGGAATTCACTAAAATTGTGGTGAAAGTT
[A/T]CAAACCCCTGGGCTAGGTGGATAAAGTTTGTCATAACTGTCCATT
GATGG
|
