|
Marker Overview
Name | TAMU_GH_TBh025G13r158 |
dbSNP ID | N/A |
SNP Array ID | TAMU_CottonSNP63K: | i37525Gh |
|
Type | SNP |
SNP Alleles | A/G |
Species | Gossypium hirsutum |
PCR Condition | Tm: optimum, 57 ; minimum, 55 ; maximum, 60 ; max difference, 2 ; product size: minimum, 50 bp; optimum, 50 bp; maximum, 100 bp |
Max Length | 50 |
Publication | [view all] |
Contact | Stelly, David M.
|
Comment | KASP assay uses a 3 primer system. Two that are allele specific, one for each SNP base and then 1 common that should not contain any SNP bases. |
Alignments
The following features are aligned
Publications
Year | Publication |
2015 | Hulse-Kemp AM, Ashrafi H, Stoffel K, Zheng X, Saski C, Scheffler BE, Fang DD, Chen ZJ, Van Deynze A, Stelly DM. BAC-End Sequence-Based SNP Mining in Allotetraploid Cotton (Gossypium) Utilizing Resequencing Data, Phylogenetic Inferences and Perspectives for Genetic Mapping. G3 (Bethesda, Md.). 2015 Apr 9. |
2015 | Hulse-Kemp AM, Lemm J, Plieske J, Ashrafi H, Buyyarapu R, Fang DD, Frelichowski J, Giband M, Hague S, Hinze LL, Kochan KJ, Riggs PK, Scheffler JA, Udall JA, Ulloa M, Wang SS, Zhu QH, Bag SK, Bhardwaj A, Burke JJ, Byers RL, Claverie M, Gore MA, Harker DB, Islam MS, Jenkins JN, Jones DC, Lacape JM, Llewellyn DJ, Percy RG, Pepper AE, Poland JA, Mohan Rai K, Sawant SV, Kumar Singh S, Spriggs A, Taylor JM, Wang F, Yourstone SM, Zheng X, Lawley CT, Ganal MW, Van Deynze A, Wilson IW, Stelly DM. Development of a 63K SNP Array for Cotton and High-Density Mapping of Intra- and Inter-Specific Populations of Gossypium spp. G3 (Bethesda, Md.). 2015 Apr 22. |
Sequence
>TAMU_GH_TBh025G13r158 ID=TAMU_GH_TBh025G13r158; Name=TAMU_GH_TBh025G13r158; organism=Gossypium hirsutum; type=genetic_marker; length=105bp AAACATGAAATGGGATTTGGGTGGGGTTGAAGCACTTGGCTAGTGTTTTC [A/G]GTAAAAAGAAAGTTGTCTGATAATCAGCATGATATATATGTATAG ACTCA
|