CSIRO_D5chr02_13879289 (genetic_marker) Gossypium hirsutum

Marker Overview
NameCSIRO_D5chr02_13879289
AliasChr02_13879289
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
5' Flanking SequenceCTTTAAAACCTTGTCCGGTTGAAACCAAAAACTGGTAGCAGGAGAAACTGGTGGTCATTA GTACCTTACTTTTCTCAAACGTTGTTGGTGTATTAAAGAA
3' Flanking SequenceTAAAAGGAAATTATGTGGTTCCAAAAATGCTTGGTCGCAAAGGTGTAAAATGTTTTCTTT GAATTCAAACTGGTTTCTTCCATTCTGTCCTTAGGATGAA
SpeciesGossypium hirsutum
GermplasmSiokra 1-4
VIR-6615
Source Typerestriction-site associated DNA
RNA-seq and restriction-site associated DNA
Restriction EnzymeEcoRI; ApekI; SbfI
Publication[view all]
ContactZhu, Qian-Hao
Wilson, Iain
CommentData obtained 2014. SNP location is based on D5 JGI 221 position
Germplasm
Stock NameType
Siokra 1-4TBD
VIR-6615breeding_germplasm
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Chr02_13879289Chr02_13879289Gossypium hirsutummarker_locus


Contact
NameDetails
Zhu, Qian-Hao
First name:Qian-Hao
Last name:Zhu
Title:Research Scientist
Institution:CSIRO
Address:CSIRO Plant Industry, GPO Box 1600, Canberra, ACT 2601,
Country:Australia
Email:Qianhao.Zhu@csiro.au
Phone:61 2 62464903
Last update:24-Aug-2014
Wilson, Iain
Description:SNPs; Disease resistance
First name:Iain
Last name:Wilson
Title:Senior Scientist
Institution:CSIRO
Address:Black Mountain Laboratories Clunies Ross Street, Black Mountain, ACT 2601
Country:Australia
Email:iain.wilson@csiro.au
Phone:+61 (0)2 62465211
Last update:28-Feb-2010
Sequence
>CSIRO_D5chr02_13879289 ID=CSIRO_D5chr02_13879289|Name=CSIRO_D5chr02_13879289|organism=Gossypium hirsutum|type=genetic_marker|length=205bp
CTTTAAAACCTTGTCCGGTTGAAACCAAAAACTGGTAGCAGGAGAAACTG
GTGGTCATTAGTACCTTACTTTTCTCAAACGTTGTTGGTGTATTAAAGAA
[C/G]TAAAAGGAAATTATGTGGTTCCAAAAATGCTTGGTCGCAAAGGTG
TAAAATGTTTTCTTTGAATTCAAACTGGTTTCTTCCATTCTGTCCTTAGG
ATGAA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1MCU-5 x Siokra 1-4, RIL (2015 SNP)MS-RIL_C01_LG02N/AAD_chr.0111.96Chr02_13879289View