NAU4058, NAU4058 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU4058
Genbank IDCO130626
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(aag)12
PCR ConditionAnnealing temperature: 57
Primer 1NAU4058_F: CCTCTCTCTTTGGCTCTACG
Primer 2NAU4058_R: CGCATTTCTATTCTCCTCCT
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO130626
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU4058_FNAU4058_FGossypium raimondiiprimer
NAU4058_RNAU4058_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.SG-BIL_ch22.ay07Gossypium hirsutum x barbadenseQTL
fiber uniformityqFU.SG-BIL_ch22.ay07.1Gossypium hirsutum x barbadenseQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fiber elongationqFEL.Y7-RIL_ch05.bb12Gossypium hirsutumQTL
fiber lengthqUHML.Y7-RIL_ch05.bb09-12.2Gossypium hirsutumQTL
fiber lengthqUHML.Y7-RIL_ch05.bb12.2Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU4058NAU4058Gossypium raimondiimarker_locus
NAU4058-230NAU4058-230Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Sequence
>NAU4058 ID=NAU4058|Name=NAU4058|organism=Gossypium raimondii|type=genetic_marker|length=226bp
CCTCTCTCTTTGGCTCTACGAATTTCAAACTTAATTTCGTTATTGGTTTT
TTTTGTTTTGCCTAGGGTTTTTGTTAAAATTTAAAAATCCAAAGAAGATT
CAAAGAAGGTAGGAGAGAAAGACAACGAGGGAGAAGTGGCATAGACGGAG
ACCAAAATTTATGAAAAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGAAGA
AGGAGTAGGAGGAGAATAGAAATGCG
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr22N/AAD_chr.2228NAU4058View
2AD-genome wide Reference Map (2009)AD-genome wide Reference Map (2009).Ref-chr05N/AAD_chr.05313NAU4058View
3Zhongmiansuo-12 x 8891, RIL (2007)Zhongmiansuo-12 x 8891, RIL (2007).Z8-RIL_ch05/A05-2N/AAD_chr.0556.6NAU4058View
4Emian-22 x 3-79, BC1 (2011)Emian-22 x 3-79, BC1 (2011).E3-BC1_chr22N/AAD_chr.22139.63NAU4058View
5(YM-1 x CCRI-35) x (YM-1 x 7235), 4WC (2012)YCY7-4WC_chr05-2N/AAD_chr.0533.7NAU4058View
6Yumian-1 x 7235, RIL (2015)Y7-RIL_chr05N/AAD_chr.05111.5NAU4058View
7(86-1 x G. anomalum) x Su8289, BC2F1 (2015)8S-BC2F1_chr04N/AB_chr.0483NAU4058View
8CCRI 12-4 x (AD)5-7, F2 (2015)CAD5-F2_chr22N/ADt.04123.6NAU4058View
9SG 747 x Giza 75, BIL (2013)SG-BIL_chr22N/AAD_chr.227.3NAU4058View
10TM-1 x Hai-7124, BC1 (2007)TM-1 x Hai-7124, BC1 (2007).TH-BC1_chr22N/AAD_chr.2217.7NAU4058-230View
11TM-1 x Hai-7124, BC1 (2008)TM-1 x Hai-7124, BC1 (2008).TH-BC1.08_chr22/D4N/AAD_chr.2217.53NAU4058-230View