NAU2616, NAU2616 (genetic_marker) Gossypium raimondii

Marker Overview
NameNAU2616
Genbank IDCO072406
TypeSSR
SpeciesGossypium raimondii
Source TypeEST
Repeat Motif(cattgc)4
PCR ConditionAnnealing temperature: 57
Primer 1NAU2616_F: TTCACATGCATCCATCTCTC
Primer 2NAU2616_R: TCCCTTTATGGAAGCTGAAG
Restriction EnzymeNotI; EcoRV
Publication[view all]
ContactZhang, Tian-Zhen
CommentPrimer data obtained in 2007-05
Cross References
External references for this genetic_marker
DatabaseAccession
DB:genbankCO072406
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
NAU2616_FNAU2616_FGossypium raimondiiprimer
NAU2616_RNAU2616_RGossypium raimondiiprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
seed cotton weight per bollqBWT.9s-F2.ch01.ay12.1Gossypium hirsutumQTL
fiber lengthqFL.9s-F2.ch01.ay14Gossypium hirsutumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NAU2616NAU2616Gossypium raimondiimarker_locus


Contact
NameDetails
Zhang, Tian-Zhen
First name:Tian-Zhen
Last name:Zhang
Title:Professor
Institution:Agricultural University of Nanjing
Address:Weigang 1#, Nanjing, Jiangsu 210095
Country:China
Email:cotton@njau.edu.cn
Phone:+86 25 84395307
Fax:+86 25 84395307
Keywords:Genetics and Breeding
Last update:18-Mar-2011
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
D01chromosomeD01:1280280..1280493 -
A01chromosomeA01:1596181..1596406 -
CM018215.1chromosomeCM018215.1:1230694..1230907 -
CM018202.1chromosomeCM018202.1:1278528..1278753 -
D5_01chromosomeD5_01:1190782..1191001 -
KI_01chromosomeKI_01:1327257..1327470 -
Chr7chromosomeChr7:37995858..37996077 +
Chr01_CRI-A2_v1.0.a1chromosomeChr01_CRI-A2_v1.0.a1:1359439..1359658 -
Chr8chromosomeChr8:21332425..21332644 +
D10_01chromosomeD10_01:59277261..59277474 +
CM016614.1chromosomeCM016614.1:1864984..1865197 -
scaffold280.1supercontigscaffold280.1:1218868..1219081 -
scaffold33_A01supercontigscaffold33_A01:7106..7331 -
D01chromosomeD01:1212780..1212993 -
Ghir_D01chromosomeGhir_D01:1255381..1255594 -
D01chromosomeD01:1195365..1195578 -
A01chromosomeA01:1485997..1486222 -
D01chromosomeD01:1233062..1233275 -
A01chromosomeA01:1528241..1528466 -
D01chromosomeD01:1045215..1045428 -
A01chromosomeA01:1493577..1493802 -
At01chromosomeAt01:911856..912081 -
scaffold20210supercontigscaffold20210:78105..78318 +
scaffold20210supercontigscaffold20210:75732..75945 +
scaffold5691supercontigscaffold5691:240888..241113 -
Gbar_D01chromosomeGbar_D01:1265824..1266037 -
Gbar_A01chromosomeGbar_A01:1273508..1273733 -
D01chromosomeD01:1223715..1223928 -
A01chromosomeA01:1344290..1344515 -
CM017623.1chromosomeCM017623.1:1340190..1340403 -
CM017610.1chromosomeCM017610.1:1479855..1480080 -
CM017649.1chromosomeCM017649.1:1264430..1264640 -
CM017636.1chromosomeCM017636.1:1335355..1335580 -
CM017701.1chromosomeCM017701.1:1299582..1299795 -
CM017688.1chromosomeCM017688.1:1412767..1412992 -
Sequence
>NAU2616 ID=NAU2616|Name=NAU2616|organism=Gossypium raimondii|type=genetic_marker|length=220bp
TTCACATGCATCCATCTCTCGAATATCCAAATCCTTGTCCCCGAACCATT
TCTTTAAGTACTCGACGCCGCGGTTCAACTCGAGGATCTGGCGAAGGGTT
TCTCTTTGAACCGTGGCGACGTTGGTTGATATGGTGTCGAACCAACGGAT
AATGTCGTGATCATTGGAGCAACCATTGCCATTGCCATTGCCATTGCTAG
CTTCAGCTTCCATAAAGGGA
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1901-001 x sGK156, F2 (2019)Chr01N/AAD_chr.010NAU2616View