DC40232

Marker Overview
NameDC40232
Genbank IDGQ394683
TypeSSR
SpeciesGossypium hirsutum
GermplasmDeltapine 90
Source SequenceMONCS1706
Source Typegenomic
Primer 1DC40232_F: GACACTTCAATTGCCTTGTTA
Primer 2DC40232_R: GGTCTTATCATCCCCCTG
Publication[view all]
ContactMonsanto
CommentPrimer data obtained in 2009-05
References
External references for this genetic_marker
DatabaseAccession
DB:genbankGQ394683
Map Positions
#Map NameLinkage GroupBinChromosomePositionLocusMapViewer
1Yumian-1 x T586, RIL (2015)YT-RIL.15_chr10N/AAD_chr.1048.8DC40232View
2CCRI-35 x Yumian-1, RIL (2015)CY-RIL_chr10N/AAD_chr.1035.9DC40232View
3CCRI-35 x Yumian-1, RIL (2017)CY-RIL.17_chr10N/AAt.1045.42DC40232-45.416View
Contact
NameDetails
Monsanto
Country:United States
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
DC40232_FDC40232_FGossypium hirsutumprimer
DC40232_RDC40232_RGossypium hirsutumprimer


The following sequence_feature feature(s) derives from this genetic_marker:

Feature NameUnique NameSpeciesType
MONCS1706MONCS1706Gossypium hirsutumsequence_feature


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
DC40232DC40232Gossypium hirsutummarker_locus
DC40232DC40232-45.416Gossypium hirsutummarker_locus


Germplasm
Stock NameType
Deltapine 90TBD
Sequence
>DC40232 ID=DC40232|Name=DC40232|organism=Gossypium hirsutum|type=genetic_marker|length=252bp
GACACTTCAATTGCCTTGTTATTATATAATTTATATATGGCTCTGCGTAA
CTCAAGCTAACCGTTATGATTATTCGACCCTTCAGTCAACAGAATCCTAA
CAAACCCTTTCTTTTTCCCCACACTCCATCGCTCTCTCTAATACCTTGCA
TTATTATTATTATTATTATTATTATTATTATTATTATATTTTTGTATTTA
CGGATATTAGGCATTGAACCTCGAATTGGTTGCACAGGGGGATGATAAGA
CC